ID: 1088398060

View in Genome Browser
Species Human (GRCh38)
Location 11:109390532-109390554
Sequence AAGGGTATTTAACCCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088398060_1088398065 14 Left 1088398060 11:109390532-109390554 CCAGCACTGGGTTAAATACCCTT No data
Right 1088398065 11:109390569-109390591 TTGCTCTCCTTTTGAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088398060 Original CRISPR AAGGGTATTTAACCCAGTGC TGG (reversed) Intergenic
No off target data available for this crispr