ID: 1088398065

View in Genome Browser
Species Human (GRCh38)
Location 11:109390569-109390591
Sequence TTGCTCTCCTTTTGAAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088398062_1088398065 -5 Left 1088398062 11:109390551-109390573 CCTTCCTCTTTCTTCACCTTGCT No data
Right 1088398065 11:109390569-109390591 TTGCTCTCCTTTTGAAACTGTGG No data
1088398061_1088398065 -4 Left 1088398061 11:109390550-109390572 CCCTTCCTCTTTCTTCACCTTGC No data
Right 1088398065 11:109390569-109390591 TTGCTCTCCTTTTGAAACTGTGG No data
1088398057_1088398065 27 Left 1088398057 11:109390519-109390541 CCTCAGGAGTTAACCAGCACTGG No data
Right 1088398065 11:109390569-109390591 TTGCTCTCCTTTTGAAACTGTGG No data
1088398060_1088398065 14 Left 1088398060 11:109390532-109390554 CCAGCACTGGGTTAAATACCCTT No data
Right 1088398065 11:109390569-109390591 TTGCTCTCCTTTTGAAACTGTGG No data
1088398063_1088398065 -9 Left 1088398063 11:109390555-109390577 CCTCTTTCTTCACCTTGCTCTCC No data
Right 1088398065 11:109390569-109390591 TTGCTCTCCTTTTGAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088398065 Original CRISPR TTGCTCTCCTTTTGAAACTG TGG Intergenic
No off target data available for this crispr