ID: 1088399551

View in Genome Browser
Species Human (GRCh38)
Location 11:109408142-109408164
Sequence ACTTGAAATAAGCCAGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088399546_1088399551 19 Left 1088399546 11:109408100-109408122 CCCATTTCCTCTGTTAGGCTGTG No data
Right 1088399551 11:109408142-109408164 ACTTGAAATAAGCCAGGAGTAGG No data
1088399547_1088399551 18 Left 1088399547 11:109408101-109408123 CCATTTCCTCTGTTAGGCTGTGT No data
Right 1088399551 11:109408142-109408164 ACTTGAAATAAGCCAGGAGTAGG No data
1088399544_1088399551 27 Left 1088399544 11:109408092-109408114 CCATTGATCCCATTTCCTCTGTT No data
Right 1088399551 11:109408142-109408164 ACTTGAAATAAGCCAGGAGTAGG No data
1088399549_1088399551 12 Left 1088399549 11:109408107-109408129 CCTCTGTTAGGCTGTGTTTAGGA No data
Right 1088399551 11:109408142-109408164 ACTTGAAATAAGCCAGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088399551 Original CRISPR ACTTGAAATAAGCCAGGAGT AGG Intergenic
No off target data available for this crispr