ID: 1088401063

View in Genome Browser
Species Human (GRCh38)
Location 11:109422945-109422967
Sequence CCGGGCCGCCGCGCGGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 318}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088401063_1088401070 -10 Not started Left 1088401063 11:109422945-109422967 CCGGAGCCCGCGCGGCGGCCCGG 0: 1
1: 1
2: 1
3: 29
4: 318
Right 1088401070 11:109422958-109422980 GGCGGCCCGGAGTGGGTGCTGGG 0: 1
1: 0
2: 2
3: 10
4: 216
1088401063_1088401071 -6 Not started Left 1088401063 11:109422945-109422967 CCGGAGCCCGCGCGGCGGCCCGG 0: 1
1: 1
2: 1
3: 29
4: 318
Right 1088401071 11:109422962-109422984 GCCCGGAGTGGGTGCTGGGAAGG 0: 1
1: 0
2: 0
3: 35
4: 421
1088401063_1088401073 -5 Not started Left 1088401063 11:109422945-109422967 CCGGAGCCCGCGCGGCGGCCCGG 0: 1
1: 1
2: 1
3: 29
4: 318
Right 1088401073 11:109422963-109422985 CCCGGAGTGGGTGCTGGGAAGGG 0: 1
1: 1
2: 2
3: 32
4: 314
1088401063_1088401076 6 Not started Left 1088401063 11:109422945-109422967 CCGGAGCCCGCGCGGCGGCCCGG 0: 1
1: 1
2: 1
3: 29
4: 318
Right 1088401076 11:109422974-109422996 TGCTGGGAAGGGTAGGATCCAGG 0: 1
1: 0
2: 0
3: 28
4: 370
1088401063_1088401078 26 Not started Left 1088401063 11:109422945-109422967 CCGGAGCCCGCGCGGCGGCCCGG 0: 1
1: 1
2: 1
3: 29
4: 318
Right 1088401078 11:109422994-109423016 AGGCGAAGACATCAACCGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 50
1088401063_1088401075 -1 Not started Left 1088401063 11:109422945-109422967 CCGGAGCCCGCGCGGCGGCCCGG 0: 1
1: 1
2: 1
3: 29
4: 318
Right 1088401075 11:109422967-109422989 GAGTGGGTGCTGGGAAGGGTAGG 0: 1
1: 0
2: 6
3: 110
4: 832
1088401063_1088401079 27 Not started Left 1088401063 11:109422945-109422967 CCGGAGCCCGCGCGGCGGCCCGG 0: 1
1: 1
2: 1
3: 29
4: 318
Right 1088401079 11:109422995-109423017 GGCGAAGACATCAACCGAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088401063 Original CRISPR CCGGGCCGCCGCGCGGGCTC CGG (reversed) Intronic
900077265 1:827596-827618 CCGGGCCGGGGCGGGGTCTCGGG + Intergenic
900155329 1:1201461-1201483 GCGGGCGGCGGAGCGGGCTCTGG - Intergenic
900255035 1:1693441-1693463 CGGGGCCGCCGCGCGGGGTGAGG + Intronic
900263778 1:1746707-1746729 CGGGGCCGCCGCGCGGGGTGAGG + Intergenic
901434018 1:9235134-9235156 CCGGGGCTCGGCGCGGCCTCGGG - Intronic
901673072 1:10867214-10867236 CACGGCCCCCGCGCGGGCTGCGG - Intergenic
902350268 1:15848537-15848559 CCCGGCTGTCGGGCGGGCTCGGG - Intronic
903153284 1:21428204-21428226 CCGGGCCGGAGCGCGGGCGGCGG + Intergenic
903263536 1:22143418-22143440 CCCGGCCGCCGCCCGGGCCTAGG + Intronic
903628251 1:24746036-24746058 GCGGGCCGCAGTTCGGGCTCCGG - Intronic
903950715 1:26994431-26994453 CGGGGCCGCGGGGCGGGCTGCGG - Exonic
904215331 1:28914525-28914547 GCGGGCCGGCGGGCGGGCTGCGG + Intronic
904253126 1:29238380-29238402 CGGGGCTGCTCCGCGGGCTCCGG + Intronic
905685185 1:39902374-39902396 CCGAGCCGCCGCGAGGGGTAGGG + Intergenic
905803681 1:40861544-40861566 CCGGCACGCCGGGCGGGCGCCGG + Exonic
907767367 1:57424159-57424181 GCGGGGCGCCGGGCGGGCGCGGG - Intronic
908473810 1:64470108-64470130 CTGGGCCGCCGCGGCGGCTGCGG - Intergenic
911208696 1:95117782-95117804 CCGGGCCGCCTCCCGCGCGCCGG - Intronic
911208706 1:95117802-95117824 CGGGGCTCCCGGGCGGGCTCCGG + Intronic
911449508 1:98045821-98045843 CCGAACCGCCCCGCAGGCTCGGG + Intergenic
912270147 1:108200317-108200339 CCTGCGCTCCGCGCGGGCTCGGG - Exonic
914490124 1:148146509-148146531 CCAGGCCCCAGCTCGGGCTCAGG - Intronic
915511336 1:156388537-156388559 CCGCGCCGCCCCGCGCGCCCCGG + Intergenic
916483388 1:165235609-165235631 CCGCGCCGCCGCGCGTTCCCAGG - Intronic
922196617 1:223364639-223364661 CCCGGCCTCCGCGCGGCCTCTGG + Intergenic
922196625 1:223364665-223364687 CCGCGCCGCGCCGCGGGCTGGGG - Intergenic
922279967 1:224114273-224114295 CCCAGCCCCCGCGCTGGCTCCGG + Exonic
922676776 1:227558459-227558481 CCGGGCTGCAGCGGGGGCGCAGG - Intergenic
922766430 1:228158769-228158791 GCGGGCGGCCGAGCGCGCTCGGG + Exonic
923055921 1:230425989-230426011 GCGGGCCGCGGCGCGGGCCCAGG - Intergenic
924699706 1:246439000-246439022 CCGGTCCTCGGCCCGGGCTCTGG + Intronic
924775218 1:247111487-247111509 CCGGGGCGCCGGGAGGACTCGGG + Exonic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1064209107 10:13348196-13348218 CCGGGCCGCCGCGCTCCCGCCGG + Exonic
1065099560 10:22320733-22320755 CCGGCCGGCCCCGCGGGCTGCGG - Intronic
1067091226 10:43266694-43266716 TGGGGCCGGGGCGCGGGCTCCGG - Intronic
1067300229 10:45001116-45001138 CCTGGCCGCCGGGCGGGGGCGGG + Intronic
1068955684 10:62817436-62817458 CCCGGCGGCAGAGCGGGCTCCGG + Intronic
1069024042 10:63521329-63521351 CCGGGCCGGCGGGCGGGGGCGGG + Intergenic
1070780169 10:79132968-79132990 CCTGGCCCCCTCGCAGGCTCTGG + Intronic
1071527491 10:86366736-86366758 CCGGGCCGGCGTGGCGGCTCTGG + Intergenic
1072169926 10:92848905-92848927 CGGGGCCGCAGCGCGGGGCCCGG - Intronic
1073196199 10:101694327-101694349 CCGGGACGCGGGGCCGGCTCGGG + Intronic
1073293387 10:102424322-102424344 TCGGGCCGCTGCAGGGGCTCTGG + Exonic
1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG + Intergenic
1073392732 10:103192969-103192991 CCGCGCCGCCGCGACGCCTCCGG - Intronic
1074503342 10:114044973-114044995 CCGGGCGGCGGCGCGGGCGCGGG - Exonic
1075616081 10:123891699-123891721 CGGGGGCGCCGGGCGGGCTGCGG + Exonic
1075693647 10:124418436-124418458 CCGGGGCGCCTCGGGGTCTCTGG + Intronic
1075802605 10:125161845-125161867 CCGGGCCGCCGCGCAAGCCCAGG - Intergenic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1076138050 10:128058463-128058485 CCGGGCAGCTGCGTGGGCCCTGG - Intronic
1076156804 10:128210979-128211001 CCTGGAGGCCGCGCGGGCACCGG - Intergenic
1076371455 10:129958782-129958804 GCGGCCCGGCGCGCGGCCTCGGG + Intronic
1076905098 10:133357557-133357579 GCGGGCAGCCGCGCGTCCTCTGG - Intronic
1078233318 11:9461514-9461536 CCAGGCCGCAGCGGGGGCGCCGG + Intronic
1079128656 11:17735354-17735376 TCGGGACGCAGGGCGGGCTCCGG - Exonic
1080283619 11:30585465-30585487 TCGGGCCGCCGCGGGAGCCCGGG + Intronic
1081846367 11:46243437-46243459 CCGGGCCGACGCGCATGCGCGGG + Intergenic
1082025156 11:47565995-47566017 CCGGGCCGAGGGGCAGGCTCGGG + Intronic
1083168373 11:60906230-60906252 ACAGGCCGCCGCTCGGCCTCCGG + Intronic
1083221747 11:61257274-61257296 CCGGCCCGGCGCGGTGGCTCAGG + Intergenic
1083335149 11:61917666-61917688 CCGGCCCGCCGCGCCGGGACAGG + Intronic
1083901777 11:65646807-65646829 GCGGGTCGCCGCCGGGGCTCAGG + Exonic
1083941988 11:65900708-65900730 CTGGGGCGGGGCGCGGGCTCTGG - Intergenic
1084041239 11:66543862-66543884 CTGGGCCGCTGCGTGGGCTTCGG - Exonic
1084149496 11:67281573-67281595 CCGGGCTGCCGCTGAGGCTCTGG + Intronic
1084175593 11:67420761-67420783 GCTGGCCGCCGTGCTGGCTCTGG + Exonic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1084935510 11:72584533-72584555 CCGGGCCGCCACGCGCACCCTGG + Exonic
1084973049 11:72781736-72781758 CCGGGGCCGCGCGGGGGCTCTGG + Intronic
1085201613 11:74705497-74705519 CCAGGCCCCAGCACGGGCTCAGG + Intronic
1085527983 11:77175137-77175159 CAGGGCTGCCACGCGGGCCCTGG + Intronic
1087141468 11:94768988-94769010 CCGGCCCGCCCGACGGGCTCTGG + Intronic
1088376291 11:109145450-109145472 CCCGGCCGCCGCCCTGTCTCTGG + Intergenic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1089745717 11:120615530-120615552 CCTGGCAGCTGCCCGGGCTCTGG + Intronic
1090806876 11:130208455-130208477 CAGGGGCGCTGCGCTGGCTCTGG - Exonic
1091349387 11:134880974-134880996 CCGGGCTGCCCCGGGGGCGCTGG + Intergenic
1091823645 12:3493539-3493561 CCCCGCTGCCGCGCGGGGTCTGG + Intronic
1091915341 12:4269226-4269248 GCGGGTCGCGGCGCTGGCTCCGG + Intergenic
1092142118 12:6191133-6191155 CCGGCCCGCCCTGCGGGCCCCGG - Intergenic
1092861894 12:12725641-12725663 CCGGGCGGGCGCGGGGGCTGGGG - Intergenic
1093547780 12:20368841-20368863 CGGGGGCGCAGGGCGGGCTCCGG - Intergenic
1096465698 12:51847035-51847057 CCGGGCGGCCGCGCGAGCTGCGG - Intergenic
1096466003 12:51848138-51848160 GCGGGCCGGCCCTCGGGCTCCGG + Intergenic
1096782766 12:54000558-54000580 CCCGGGCGCCGCGCGGACTGCGG + Exonic
1097787789 12:63780070-63780092 CCGGGTCCCCGCGGGGCCTCAGG + Exonic
1101371845 12:104137933-104137955 CCGGGCCGGGGAGCGGGCGCGGG - Intronic
1101466912 12:104958333-104958355 CGGGGCTGCCGCGCGGGGGCGGG - Intronic
1102853911 12:116277347-116277369 CCGGCCCGCAGCGCCGGCCCGGG - Intergenic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1103905508 12:124325490-124325512 CCGGGCCTCCCCGCGGGCAGCGG - Exonic
1104633572 12:130424507-130424529 CCAGGCCGCTGTCCGGGCTCCGG + Intronic
1104826230 12:131711364-131711386 CCGGGACGACGAGCGGGCCCTGG + Exonic
1104892803 12:132148541-132148563 CCTGGCAGCTGCTCGGGCTCTGG + Intronic
1105492606 13:20902930-20902952 CCCGGCCGCCGCGCTGGGGCGGG + Intronic
1106517263 13:30465727-30465749 TCCGGCCGCCGCGCGGGCTGGGG + Intronic
1112580713 13:100674626-100674648 CCGGGCCGCCGTGCGGGGCTCGG + Intronic
1113656843 13:112072835-112072857 CCGGGCCTCCTCGGGGCCTCGGG + Intergenic
1113905760 13:113818493-113818515 CCAGGCCTCCACGCTGGCTCCGG - Intergenic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1118809037 14:69260519-69260541 CTCGGCCGCCGCGCAGGGTCTGG - Intronic
1119456857 14:74763571-74763593 CCGGGCCCCGGCGAGGCCTCAGG - Exonic
1122650017 14:103220963-103220985 CCCGGCCCCTGCGCGGGCACTGG - Intergenic
1122689009 14:103522765-103522787 CCGGGCGGCCGGGCGGGGGCGGG + Exonic
1122697447 14:103562899-103562921 CCGCGCCGCCGCGCTTCCTCGGG + Intergenic
1122771856 14:104101180-104101202 CCGGGCTGCCGGGCCGGTTCTGG + Intronic
1122840838 14:104461851-104461873 CCGGGCAGCCGGGAGGGCGCAGG - Intergenic
1122971051 14:105152382-105152404 CAGGGCCGGCGGGCGGCCTCAGG + Intronic
1123038052 14:105479248-105479270 CCGGGCAGGGGCGCGGGGTCGGG + Intronic
1123716753 15:23039336-23039358 CGGGACCCACGCGCGGGCTCCGG + Intronic
1127225051 15:56919151-56919173 TCGGGCCGGCGCCCAGGCTCCGG + Intronic
1128067905 15:64775711-64775733 CCCGCCCGCCGCGCGGTCTCCGG + Intergenic
1128075716 15:64824136-64824158 CGCGGCCGCCCCGCGGGCCCTGG + Exonic
1131144599 15:90002549-90002571 CCAGGTGGGCGCGCGGGCTCGGG + Intronic
1131257316 15:90871365-90871387 CCGGGCGGCCGCGAGGACTTTGG + Intronic
1132942410 16:2514582-2514604 CCGCGCCGCCGCCCGCGCACTGG - Intronic
1133188343 16:4116030-4116052 CCCGGCCGCCCCCCGCGCTCCGG + Exonic
1133188563 16:4116715-4116737 CCCGGGCGGCGCGCGGCCTCTGG - Intergenic
1135479927 16:22814080-22814102 CCTGGGCGCGGCGCGGGCTCGGG + Intergenic
1136478449 16:30526953-30526975 CCCGGTAGCCCCGCGGGCTCCGG - Intronic
1136522422 16:30805676-30805698 CCGGGCCGGCGTCCGGGCCCAGG + Intergenic
1137056618 16:35749246-35749268 CCGGGCCGCGGTGGGGGCACAGG - Intergenic
1139215896 16:65123586-65123608 CCGGGCGGCTGCGGGCGCTCGGG - Intronic
1140512319 16:75517170-75517192 CGGGGACGCCGCCCGGACTCGGG + Intergenic
1141683233 16:85556014-85556036 CCGGGCAGCCGTGGAGGCTCCGG + Intergenic
1142271923 16:89094194-89094216 CGGGGCCCCCGCGCGGGGTGCGG + Intronic
1142670648 17:1486010-1486032 CGCGGCGGCCGCGCGGGTTCCGG - Intronic
1142876385 17:2853896-2853918 GGGGGCCGGGGCGCGGGCTCAGG + Intronic
1143590840 17:7885213-7885235 CCGGACCGCCGCGGGGCCACGGG - Intronic
1144107283 17:11997432-11997454 TCGGCCCGCGGCGCCGGCTCCGG + Intronic
1144769573 17:17752200-17752222 GCGGGGCGGCGCGCGGGCGCAGG + Intronic
1144944259 17:18961736-18961758 CCGGGGCCCCGTGGGGGCTCTGG - Intronic
1145884221 17:28371557-28371579 CCGGGCCGACGCCCCGCCTCTGG - Intronic
1147743740 17:42682940-42682962 CGGGGCCGCCCTGCAGGCTCTGG - Intronic
1148081063 17:44967927-44967949 CCGGGGCCCCGCGCGGGGTAGGG + Exonic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149833679 17:59893365-59893387 CGGGGCGGCGGCGCGGGCTCAGG + Intronic
1150239939 17:63622914-63622936 CCGGGCCGCGGCGCGCGAGCGGG - Intronic
1150488528 17:65560098-65560120 CCGACCCCCCGCCCGGGCTCGGG - Intronic
1150488919 17:65561355-65561377 CCGAGCCGCGGCGTGGGCGCGGG - Intronic
1150764633 17:67993571-67993593 GCGCGCCGCCGCGCTGGCCCCGG - Intronic
1151370605 17:73644420-73644442 CCGGGTCGCCGGCCGAGCTCCGG + Intergenic
1152321559 17:79610884-79610906 CCCGGCCGCCGAGCGGGCAGCGG + Intergenic
1152356504 17:79810137-79810159 GCGCGCCGCCGAGCGGGCTGCGG - Intergenic
1152361055 17:79833039-79833061 GCGGGCCGCGGCGCCGGCGCAGG - Intergenic
1152463815 17:80454872-80454894 GCGCGCCGCCGCGCTGGCTCCGG - Intergenic
1152714392 17:81891490-81891512 CCCGGCCGCCTCGCTGGCTCCGG + Exonic
1152739615 17:82013200-82013222 CCGAGCTGCCGGGCGGACTCCGG + Intronic
1152921150 17:83067209-83067231 CCTGTCTGCCGCGCGGCCTCCGG + Intergenic
1153457319 18:5295567-5295589 GCGGGCCGGCGAGCGGGCTCGGG - Intronic
1154196543 18:12271437-12271459 CAGGGCCGCCGTGGGGGCTGCGG - Intronic
1154204434 18:12325204-12325226 CTGGGCGGCGGCACGGGCTCAGG + Exonic
1154210777 18:12377107-12377129 CCGGGACGCTGCGCAGGCGCGGG + Exonic
1154214883 18:12408334-12408356 CCCGGCCGCCCCCCCGGCTCCGG - Intronic
1154255441 18:12777598-12777620 CCGGGCTCCCGAGCGGGCTGAGG + Intergenic
1155508234 18:26550964-26550986 CCCGGGGGCCGCGCTGGCTCCGG + Intronic
1156171636 18:34493611-34493633 CCGGGCTGCCGCGCTGCCCCCGG + Intronic
1156350448 18:36297683-36297705 CCGGGCTGCAGCCCGGGCTCCGG - Intergenic
1157464200 18:47930529-47930551 CCGGGCCGCCGGCCGGGCCCGGG - Exonic
1157610102 18:48950613-48950635 CCGGGCCCCCGCGCGCGCCCCGG - Exonic
1157613955 18:48976039-48976061 CCGGGAGGCGGCGCGAGCTCTGG - Intergenic
1158401016 18:57121832-57121854 CCCGGCCGCTGACCGGGCTCAGG - Intergenic
1158938351 18:62384947-62384969 CGGGGCCGCCGCACGGGTCCGGG - Exonic
1160453561 18:78980529-78980551 CTCGGCGGCCGCGCGCGCTCCGG - Intronic
1160453654 18:78980825-78980847 CCGGGCCCCCGCACCGCCTCGGG + Intronic
1160499733 18:79395795-79395817 CCGGGGCCCCGCGCGGGCCCGGG + Intergenic
1160768793 19:821386-821408 CGGGGCAGCTGCGCCGGCTCCGG + Intronic
1160905485 19:1449972-1449994 TCGGGCCTCCGCGCGGGCTCAGG - Intronic
1160939718 19:1614579-1614601 CCGGGCCGGGGCTCTGGCTCCGG + Intronic
1160992205 19:1864414-1864436 CCGGGCCCCGCCGCGGGCGCGGG - Intergenic
1160995781 19:1881430-1881452 CCAGGCCCCGGCTCGGGCTCAGG + Exonic
1161101791 19:2425195-2425217 GGGGGTCGCGGCGCGGGCTCGGG - Exonic
1161156134 19:2732704-2732726 CCGGGGCTCCCGGCGGGCTCCGG + Exonic
1161346647 19:3771715-3771737 CCGGCCCCTCGCCCGGGCTCAGG + Exonic
1161355825 19:3819219-3819241 GCCGGCCGCCGCCCGGGCTGTGG + Exonic
1161959553 19:7516207-7516229 CCGGCCCGCCGCGCCCGCGCCGG - Exonic
1161960401 19:7520001-7520023 GCGGGCCGCCGTGCGTGCGCAGG - Exonic
1162022349 19:7873638-7873660 AGGGGCCGCCGCGCGGACGCCGG - Exonic
1162144437 19:8605242-8605264 CCGTGCCGCGGCGCTGCCTCCGG + Exonic
1165349388 19:35268097-35268119 CCGGCCGGCGGCGCGGGCGCGGG - Intergenic
1166314016 19:41978580-41978602 CGAGGCTGCCGGGCGGGCTCTGG - Intronic
1166317494 19:41997302-41997324 CCGGGCCGCCGCCCAGGAACGGG + Intronic
1166996155 19:46720562-46720584 CCTGGCCGCCACGCTGGCTGGGG - Exonic
1167258127 19:48443092-48443114 CGCGGCCACCGCGCGGGCGCCGG - Exonic
1167258227 19:48443430-48443452 CCGGACCGCTGCGCGGGGGCAGG - Exonic
1167638468 19:50668028-50668050 GCGGGCAGCGGCGCGGGCTACGG - Exonic
1168075714 19:53980141-53980163 CCGGGCCCCCGGGGGTGCTCGGG - Intronic
925609446 2:5691799-5691821 CGGGGCTACCGGGCGGGCTCGGG + Intergenic
925610453 2:5697035-5697057 CGGGCCTGCCGCGAGGGCTCGGG - Exonic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
927472401 2:23385838-23385860 CCTGGCCGCCGCGTGGGGCCGGG + Intronic
928094132 2:28393606-28393628 GCCGGCCGCGCCGCGGGCTCTGG - Exonic
929452881 2:42048338-42048360 CCGGGCCGTCGCGGGGGCCGCGG + Exonic
929936657 2:46298385-46298407 TTGGGCCGCGGCGCGGGCACAGG - Intronic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
930011518 2:46941399-46941421 CCGGGCGGCAGCGGGGGCCCGGG - Exonic
935237499 2:101151092-101151114 CCCGGCCGCCGCGCCCGCCCCGG + Intronic
935591871 2:104852485-104852507 CTGGGCTGCCGCTCGGGCTCGGG + Intergenic
935595171 2:104872554-104872576 CCTGGCCGCCGCGGGAACTCGGG - Intergenic
935645321 2:105329645-105329667 CCGCGCCGCCCCGCGGCCTGGGG + Exonic
936433268 2:112482241-112482263 CCGGGCCGCGGCGGGCGCCCGGG + Exonic
936525157 2:113236463-113236485 CCGGGCCGCCAGGTGGGCCCAGG - Intronic
936569444 2:113602375-113602397 CCGGGCGGGCGGGCGGGCTGAGG + Intergenic
938073097 2:128318639-128318661 CCGGGCCGGAGCGCGGGCGGCGG - Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
940036814 2:149320401-149320423 CGGAGCCACCCCGCGGGCTCAGG + Intergenic
940639639 2:156333027-156333049 CCGAGCCGCTGCGCGGGCGCAGG - Intronic
947435397 2:230068341-230068363 CAAGGCCGCCGCGGGGGCTTGGG - Intronic
947741361 2:232486483-232486505 CCGGGCTGCCGCGCTGGAACCGG - Exonic
948116082 2:235494857-235494879 CCGGGCCGCCTTGGGGCCTCGGG + Intronic
948467389 2:238158896-238158918 GCGGGCGGGCGCGCGGTCTCGGG + Intergenic
948645337 2:239400765-239400787 ACCCGCCGGCGCGCGGGCTCGGG + Exonic
948645376 2:239400871-239400893 GCGGGCGGGTGCGCGGGCTCGGG + Exonic
948805758 2:240452974-240452996 TCCGGGCGGCGCGCGGGCTCTGG - Intronic
948806636 2:240455997-240456019 CCAGGCCGGCGCCCGAGCTCTGG + Intronic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1171123199 20:22582875-22582897 CCTGCCCCCCGAGCGGGCTCAGG + Exonic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1172474524 20:35226876-35226898 CCCGGGCGCCGCGCGGGCGGCGG + Exonic
1172474570 20:35226999-35227021 CGGGGCCGGGGCGCGGGCTCGGG + Intronic
1172618705 20:36306395-36306417 CCCGGCCCCCGCCCCGGCTCCGG - Exonic
1173788545 20:45812764-45812786 CGGGGGCGCCGCCCGGGGTCCGG + Exonic
1174017736 20:47502202-47502224 GCGGGCCGCCCCCCGGGCTGAGG - Intronic
1175415928 20:58800939-58800961 CAGGGCCCCCACGCCGGCTCAGG + Intergenic
1176068845 20:63215813-63215835 CGGGGCCGAGGCGCGGGGTCTGG - Intronic
1176194433 20:63830900-63830922 CCCAGCTGCGGCGCGGGCTCCGG - Intronic
1178707747 21:34889175-34889197 CTGGGCGGCCGCGCAGGATCTGG - Intronic
1178708048 21:34890177-34890199 TCGGGACGCGCCGCGGGCTCTGG + Intronic
1180744414 22:18077980-18078002 CCGGGACGCCGCGCGGCTGCGGG + Exonic
1180951934 22:19724388-19724410 CCGGGCTGCGGCGCGAGCGCGGG - Exonic
1181057761 22:20268030-20268052 CCCCGCCGCCGGCCGGGCTCGGG + Intronic
1181256849 22:21568159-21568181 CGGTTCCGCGGCGCGGGCTCCGG - Intronic
1181334522 22:22117872-22117894 CCAGGCCCCGGCTCGGGCTCAGG + Intergenic
1182904002 22:33920897-33920919 GTGGGCCGCCGCGCGGGAACCGG + Intronic
1183313566 22:37124835-37124857 CCGGGCAGCCGCTGGGGCCCTGG - Intergenic
1183466604 22:37983327-37983349 CCCGACCGCCCCCCGGGCTCGGG - Intronic
1183720131 22:39557771-39557793 CCGGGCCGGGGCGGGGGCGCGGG - Intergenic
1184086899 22:42270692-42270714 CCGGGCCGCGGCGCGCGGGCGGG + Intronic
1184681015 22:46072083-46072105 CCGGGCCGTCGGGCGGGCGGTGG - Intronic
1185056150 22:48579303-48579325 CAGGGCCGCAGCGTGGGGTCCGG + Intronic
1185278817 22:49961240-49961262 TCGGACCGCCGGGCGGGCCCGGG + Intronic
1185338277 22:50280431-50280453 CGGGGCGGCCGCAGGGGCTCTGG - Intronic
949987542 3:9552744-9552766 CCGGGCTGCCGGGCGGGAGCTGG + Exonic
950345551 3:12288572-12288594 CAGGGGTGCCGCGCGGCCTCAGG - Intronic
950683898 3:14602984-14603006 CCGGGCCGCAGGGCGGCCGCGGG - Intergenic
953485057 3:43286878-43286900 CCAGGCCGCGCCGCGGGGTCCGG - Intronic
954437359 3:50503289-50503311 CCGGGCCCCCGCGCCCGCTGTGG - Exonic
957865015 3:86012435-86012457 CAGGGCCGGCGCGCGGGCGAGGG - Intronic
959530742 3:107431559-107431581 TCGGGCGGAAGCGCGGGCTCCGG + Intergenic
961081521 3:124032922-124032944 CGGGGCCGCCGGGCGAGCCCGGG - Intergenic
962808893 3:138945765-138945787 CGGGGCCGCCGCGCCGCCGCCGG - Exonic
963116979 3:141738537-141738559 CAGGGCCGCCCTGCGGCCTCCGG + Intronic
964041634 3:152268639-152268661 CACGGCGCCCGCGCGGGCTCCGG + Exonic
966684826 3:182682729-182682751 CCGGGCCGGCGCGCGGGGGGCGG - Intergenic
967511865 3:190322214-190322236 TCGGGCGCCCGCGCTGGCTCAGG + Exonic
968512992 4:1003484-1003506 CCGGGCCGCGGCGCGGGTTAGGG - Intronic
968803196 4:2756304-2756326 CCGGGAGGCCGCGCGGCCGCCGG + Exonic
968907981 4:3463339-3463361 CCGCGCCGCCGCGCTCGCCCCGG - Exonic
969597833 4:8158897-8158919 CCGGGCGGCAGCGGGGGCGCGGG - Intergenic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
972587048 4:40447595-40447617 CCGGTCCGCTGCACTGGCTCAGG + Intronic
973945341 4:55949152-55949174 CCGGGAGGCCGCGCGGCCGCGGG + Intronic
976184398 4:82430206-82430228 CCCGGGCCCCGCGCGGCCTCTGG + Exonic
985129011 4:186723561-186723583 CCGGTCCCCGGCTCGGGCTCCGG - Intronic
989582000 5:43042116-43042138 CAGCGCCGCCGCACGGGTTCCGG - Intronic
991900558 5:71455808-71455830 CCGGGCAGCCGCCGGGGCTCGGG + Exonic
993900942 5:93584181-93584203 CCCGGCCTCCGCTCGCGCTCCGG + Exonic
997265021 5:132490406-132490428 CCGGGCCTCCGCGCGGGCTCCGG - Intronic
997521380 5:134526332-134526354 CCGGGCCGGCGAGGGGGCGCGGG + Intronic
997653009 5:135536029-135536051 CCGGGCTGCCGCGGGGGCGGAGG - Intergenic
999767974 5:154755410-154755432 CCGGGCCGCCCCGGGGGCGGGGG + Intronic
1001401891 5:171450943-171450965 GCGGGCCGCGGCGTGGGCACGGG - Intronic
1001496073 5:172188370-172188392 CCGGGCCGGTGGGCGGGCGCGGG - Exonic
1002457619 5:179354594-179354616 CCGGGGCACCGTGTGGGCTCTGG - Intergenic
1002888151 6:1313371-1313393 TCGGGCCGCAGCCCGGGCGCGGG - Exonic
1002926768 6:1609687-1609709 CCGGGCGCCGGCGCGGGCGCAGG + Intergenic
1003097982 6:3157270-3157292 CGAGGCCGCCGGGCGGGGTCCGG - Intronic
1003633218 6:7807558-7807580 CCGGCCGGGCGCGTGGGCTCAGG - Intronic
1004174572 6:13328549-13328571 CCAGGTCGCCGGGCGGGCGCCGG + Intronic
1004615085 6:17281551-17281573 CCGCCCCGCGGCTCGGGCTCCGG - Exonic
1004650186 6:17600609-17600631 TGGAGCCGCCGCGCGAGCTCAGG + Exonic
1004908511 6:20259670-20259692 CCGGCCCGCCCCGCCGGCCCGGG + Intergenic
1005900477 6:30213177-30213199 CCAGGCCCCCGGGCGGGCTCAGG - Intronic
1006472783 6:34237692-34237714 CCGGGCCCGGGCTCGGGCTCGGG - Intronic
1007347132 6:41239695-41239717 CCGGGCTCCCGCGGGGGCGCAGG + Intergenic
1007371280 6:41428191-41428213 CGTGGCCGCCGCGCCGCCTCCGG - Intergenic
1007479795 6:42142449-42142471 CCTGGCGCCCGCGCGGGCTGCGG - Intronic
1008030494 6:46688537-46688559 GCAGGCTGCGGCGCGGGCTCAGG + Exonic
1008941157 6:57046962-57046984 CCGGCCCCCCGCACGGGCCCTGG + Intronic
1008945346 6:57090460-57090482 CCGGCCCCCCGCACGGGCCCTGG + Intronic
1012401413 6:98845242-98845264 CCGCCCCGCCCCGCGGGCCCCGG + Intergenic
1013106205 6:107028395-107028417 TCGGGACGCCCCGCGAGCTCAGG + Exonic
1014569872 6:122996256-122996278 CCGGGCTGCGGCGGCGGCTCCGG - Exonic
1015220675 6:130801590-130801612 CCGGACCGCCGCGGGGCCACGGG + Intergenic
1015724819 6:136289438-136289460 ACGGGAGGCCGCGCGGGCTGTGG + Intronic
1016010675 6:139135211-139135233 CCTGGCCGCCGCGCCCTCTCCGG - Exonic
1017559900 6:155615688-155615710 CCGGGCCCCAGGGCGGTCTCAGG - Intergenic
1020100031 7:5389304-5389326 CCTGCCCACCGCGGGGGCTCCGG - Exonic
1021958804 7:25852590-25852612 CCGCGCCCCCGCCCCGGCTCGGG + Intergenic
1025021161 7:55481254-55481276 CCTGGCTGCCCAGCGGGCTCTGG - Intronic
1029110875 7:98212447-98212469 CCGGGCCGCAGCAAGGGCTCCGG + Exonic
1029298318 7:99558896-99558918 CCGGGCCTCCGCGCACTCTCGGG - Exonic
1032130726 7:129225257-129225279 CCGGTCCCCGGCCCGGGCTCGGG + Exonic
1034494012 7:151409645-151409667 CGGAGCCGCCGCGCGGACCCCGG - Intronic
1035515908 8:232286-232308 CCGGGCCGGGGCGGGGTCTCGGG - Intronic
1035612150 8:973811-973833 CCGGACCGCCGCGGGGCCACGGG - Intergenic
1036195271 8:6708499-6708521 CCGCGCCGCCGCCCGGGGCCGGG - Exonic
1036554661 8:9848017-9848039 CCGGCCGGCCGCGCTGGCCCCGG - Intergenic
1037450645 8:19013532-19013554 CGGGGCCGGGGCGCGGGCGCGGG - Intronic
1039948940 8:42153031-42153053 CCCGCCCGCCGCGCGCGCTGAGG - Exonic
1041511473 8:58659237-58659259 CCGGAAGGCCGCGCGGGGTCCGG - Exonic
1042829243 8:73008913-73008935 CCGCACAGCCCCGCGGGCTCGGG - Exonic
1043873950 8:85464176-85464198 CCGGGCCGGCATCCGGGCTCGGG - Intronic
1045211661 8:100106009-100106031 CGGCGACGGCGCGCGGGCTCCGG + Exonic
1045216906 8:100158067-100158089 CGCGGCCGCCGCACCGGCTCTGG - Intronic
1045583434 8:103501596-103501618 GCGGGCGGCGGCGCGGGCTAGGG + Intronic
1046770356 8:118111670-118111692 CCGGGCCGCCGCGCGTCCCGGGG - Exonic
1047202904 8:122781589-122781611 CCGAGCTGCCACCCGGGCTCGGG - Exonic
1049509005 8:143018482-143018504 CCAGGCAGCCGCGCGGCCCCGGG - Intronic
1049585038 8:143429150-143429172 CCGGGCCGACGCGCGCGAACGGG + Exonic
1049616596 8:143578277-143578299 CCGCGCCGCCGCGCGCGCCTCGG + Exonic
1049620942 8:143598015-143598037 CGGGGCCGCGGCCCGGGCGCGGG - Exonic
1049813819 8:144588707-144588729 CCGTGCCGCCGTGCTGCCTCCGG - Intronic
1050090956 9:2016288-2016310 CCTGGCGGCAGCGCAGGCTCGGG + Intronic
1057054453 9:91950000-91950022 TCGGGCCGGGGCGCGGGGTCGGG + Exonic
1057225293 9:93289665-93289687 CCGGGCCTGCGCCCGGGCTCCGG - Intronic
1057313450 9:93955244-93955266 TCGGGGCGGCGCGCGGGCGCCGG + Exonic
1057488605 9:95506022-95506044 CCGGGCCGCGGAGCGGGGCCGGG + Intronic
1059021312 9:110579568-110579590 CCGAGCCGCCGCCTGCGCTCCGG - Exonic
1059234500 9:112750690-112750712 CCGGGCGGCCGCGGCGCCTCGGG + Intergenic
1060770113 9:126326616-126326638 CGGGGCGGCGGCGCGGGCTCGGG + Intergenic
1060811474 9:126613397-126613419 CCGGGCGGCGGCGCCTGCTCGGG - Intergenic
1060952605 9:127613115-127613137 CCGGGCCGCGCCGCGGTCCCTGG + Intronic
1061248443 9:129413424-129413446 CCGGGGGGCCGCCCGAGCTCCGG + Intergenic
1061248891 9:129415124-129415146 CAGGGCCGCAGTGGGGGCTCAGG - Intergenic
1061286435 9:129626065-129626087 CCCCTCCCCCGCGCGGGCTCCGG - Intronic
1061293718 9:129666175-129666197 CGGGGCCGGGGCGCGGGGTCCGG + Intronic
1061366297 9:130173705-130173727 CCGGGCAGCTGCGTGGGCCCAGG + Intronic
1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG + Intronic
1062499337 9:136845590-136845612 CCGGGCTGCTGCGCGGGTGCGGG - Exonic
1062542098 9:137046030-137046052 CAGGGGCTCGGCGCGGGCTCCGG + Exonic
1062653440 9:137590149-137590171 CCAGGCCTCCGCGCGGGGCCGGG - Intronic
1185456158 X:311830-311852 CGGGGCCGCCGTGCGGACACGGG + Intronic
1187067298 X:15854210-15854232 CTCAGCCGCGGCGCGGGCTCGGG + Intronic
1189281207 X:39821222-39821244 CCCGGGCGCCGCTCGGGCTAGGG + Intergenic
1189333110 X:40155006-40155028 GCGGGCCGCGGCGGGCGCTCGGG - Intronic
1199772628 X:150984123-150984145 GCGGGGCGCCCGGCGGGCTCCGG + Intronic
1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG + Exonic