ID: 1088402508

View in Genome Browser
Species Human (GRCh38)
Location 11:109436669-109436691
Sequence TCCTGCAGTCCCTAATCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088402505_1088402508 13 Left 1088402505 11:109436633-109436655 CCACCTTGGCTATGTGGACCATG No data
Right 1088402508 11:109436669-109436691 TCCTGCAGTCCCTAATCAGTAGG No data
1088402507_1088402508 -5 Left 1088402507 11:109436651-109436673 CCATGAAAAGAAGCTCATTCCTG No data
Right 1088402508 11:109436669-109436691 TCCTGCAGTCCCTAATCAGTAGG No data
1088402506_1088402508 10 Left 1088402506 11:109436636-109436658 CCTTGGCTATGTGGACCATGAAA No data
Right 1088402508 11:109436669-109436691 TCCTGCAGTCCCTAATCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088402508 Original CRISPR TCCTGCAGTCCCTAATCAGT AGG Intergenic
No off target data available for this crispr