ID: 1088407201

View in Genome Browser
Species Human (GRCh38)
Location 11:109495150-109495172
Sequence TACTGCAATAGCCTCTTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088407201_1088407206 0 Left 1088407201 11:109495150-109495172 CCAATGAAGAGGCTATTGCAGTA No data
Right 1088407206 11:109495173-109495195 ATCAAGATGGGGTAGGCTTATGG No data
1088407201_1088407205 -7 Left 1088407201 11:109495150-109495172 CCAATGAAGAGGCTATTGCAGTA No data
Right 1088407205 11:109495166-109495188 TGCAGTAATCAAGATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088407201 Original CRISPR TACTGCAATAGCCTCTTCAT TGG (reversed) Intergenic
No off target data available for this crispr