ID: 1088407205

View in Genome Browser
Species Human (GRCh38)
Location 11:109495166-109495188
Sequence TGCAGTAATCAAGATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088407201_1088407205 -7 Left 1088407201 11:109495150-109495172 CCAATGAAGAGGCTATTGCAGTA No data
Right 1088407205 11:109495166-109495188 TGCAGTAATCAAGATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088407205 Original CRISPR TGCAGTAATCAAGATGGGGT AGG Intergenic
No off target data available for this crispr