ID: 1088408501

View in Genome Browser
Species Human (GRCh38)
Location 11:109507368-109507390
Sequence TGGTGCCACCCAGTCACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088408497_1088408501 29 Left 1088408497 11:109507316-109507338 CCGAATGGACACATCACTTTTGT No data
Right 1088408501 11:109507368-109507390 TGGTGCCACCCAGTCACCAAAGG No data
1088408500_1088408501 -8 Left 1088408500 11:109507353-109507375 CCAGATATAATAATATGGTGCCA No data
Right 1088408501 11:109507368-109507390 TGGTGCCACCCAGTCACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088408501 Original CRISPR TGGTGCCACCCAGTCACCAA AGG Intergenic