ID: 1088410348

View in Genome Browser
Species Human (GRCh38)
Location 11:109527043-109527065
Sequence GCATTTTAACTTCTGAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088410348_1088410351 -2 Left 1088410348 11:109527043-109527065 CCCTGATTCAGAAGTTAAAATGC No data
Right 1088410351 11:109527064-109527086 GCCTAGCAGGAACTCAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088410348 Original CRISPR GCATTTTAACTTCTGAATCA GGG (reversed) Intergenic
No off target data available for this crispr