ID: 1088411980

View in Genome Browser
Species Human (GRCh38)
Location 11:109544287-109544309
Sequence AAATTACCCTTTAAGTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088411980_1088411984 22 Left 1088411980 11:109544287-109544309 CCCTAGAACTTAAAGGGTAATTT No data
Right 1088411984 11:109544332-109544354 CTCAGGAGTCATGCAACTAGAGG No data
1088411980_1088411983 5 Left 1088411980 11:109544287-109544309 CCCTAGAACTTAAAGGGTAATTT No data
Right 1088411983 11:109544315-109544337 AAAGAAAGAAATTACGGCTCAGG No data
1088411980_1088411982 -1 Left 1088411980 11:109544287-109544309 CCCTAGAACTTAAAGGGTAATTT No data
Right 1088411982 11:109544309-109544331 TAAAAAAAAGAAAGAAATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088411980 Original CRISPR AAATTACCCTTTAAGTTCTA GGG (reversed) Intergenic
No off target data available for this crispr