ID: 1088413834

View in Genome Browser
Species Human (GRCh38)
Location 11:109567518-109567540
Sequence TGCTGGCCTTCTCTGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088413834_1088413845 18 Left 1088413834 11:109567518-109567540 CCTCCCTGCAGAGAAGGCCAGCA No data
Right 1088413845 11:109567559-109567581 CCTCCCAGCCATGGTTTCTGTGG No data
1088413834_1088413841 9 Left 1088413834 11:109567518-109567540 CCTCCCTGCAGAGAAGGCCAGCA No data
Right 1088413841 11:109567550-109567572 GGCCCTGCTCCTCCCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088413834 Original CRISPR TGCTGGCCTTCTCTGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr