ID: 1088418319

View in Genome Browser
Species Human (GRCh38)
Location 11:109614518-109614540
Sequence TCCAGTTCGTGTGCATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088418319_1088418320 -6 Left 1088418319 11:109614518-109614540 CCTCTTCATGCACACGAACTGGA No data
Right 1088418320 11:109614535-109614557 ACTGGAAAATCAAGAAGAAATGG 0: 3
1: 286
2: 9859
3: 4506
4: 3678
1088418319_1088418321 6 Left 1088418319 11:109614518-109614540 CCTCTTCATGCACACGAACTGGA No data
Right 1088418321 11:109614547-109614569 AGAAGAAATGGATAAATCCCCGG 0: 29
1: 3765
2: 3632
3: 2983
4: 2526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088418319 Original CRISPR TCCAGTTCGTGTGCATGAAG AGG (reversed) Intergenic
No off target data available for this crispr