ID: 1088421195

View in Genome Browser
Species Human (GRCh38)
Location 11:109649144-109649166
Sequence TAACCATCCCCCAATGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088421193_1088421195 29 Left 1088421193 11:109649092-109649114 CCTTCTCTTCTGTAAAATACAGT No data
Right 1088421195 11:109649144-109649166 TAACCATCCCCCAATGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088421195 Original CRISPR TAACCATCCCCCAATGCCTG TGG Intergenic
No off target data available for this crispr