ID: 1088423611

View in Genome Browser
Species Human (GRCh38)
Location 11:109675832-109675854
Sequence ATGGAGAAGAAGTCTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088423599_1088423611 18 Left 1088423599 11:109675791-109675813 CCTGTGATTCTGTCTTTGGTGGG No data
Right 1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088423611 Original CRISPR ATGGAGAAGAAGTCTGGGGA GGG Intergenic
No off target data available for this crispr