ID: 1088429643

View in Genome Browser
Species Human (GRCh38)
Location 11:109744951-109744973
Sequence TGGAAAATACAGAGAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088429643_1088429644 -6 Left 1088429643 11:109744951-109744973 CCATGTTCTCTCTGTATTTTCCA No data
Right 1088429644 11:109744968-109744990 TTTCCAGACTTCTGTAGAGTTGG No data
1088429643_1088429647 19 Left 1088429643 11:109744951-109744973 CCATGTTCTCTCTGTATTTTCCA No data
Right 1088429647 11:109744993-109745015 TGAAACTACATGCTGAGATCTGG No data
1088429643_1088429649 27 Left 1088429643 11:109744951-109744973 CCATGTTCTCTCTGTATTTTCCA No data
Right 1088429649 11:109745001-109745023 CATGCTGAGATCTGGCCAGTGGG No data
1088429643_1088429648 26 Left 1088429643 11:109744951-109744973 CCATGTTCTCTCTGTATTTTCCA No data
Right 1088429648 11:109745000-109745022 ACATGCTGAGATCTGGCCAGTGG No data
1088429643_1088429645 -5 Left 1088429643 11:109744951-109744973 CCATGTTCTCTCTGTATTTTCCA No data
Right 1088429645 11:109744969-109744991 TTCCAGACTTCTGTAGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088429643 Original CRISPR TGGAAAATACAGAGAGAACA TGG (reversed) Intergenic
No off target data available for this crispr