ID: 1088431917

View in Genome Browser
Species Human (GRCh38)
Location 11:109768289-109768311
Sequence CGCTTTAAGAGGGATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088431917_1088431925 -5 Left 1088431917 11:109768289-109768311 CCCTCCACATCCCTCTTAAAGCG No data
Right 1088431925 11:109768307-109768329 AAGCGTTTGGGACTCATGAAGGG No data
1088431917_1088431924 -6 Left 1088431917 11:109768289-109768311 CCCTCCACATCCCTCTTAAAGCG No data
Right 1088431924 11:109768306-109768328 AAAGCGTTTGGGACTCATGAAGG No data
1088431917_1088431926 -1 Left 1088431917 11:109768289-109768311 CCCTCCACATCCCTCTTAAAGCG No data
Right 1088431926 11:109768311-109768333 GTTTGGGACTCATGAAGGGATGG No data
1088431917_1088431927 29 Left 1088431917 11:109768289-109768311 CCCTCCACATCCCTCTTAAAGCG No data
Right 1088431927 11:109768341-109768363 TTCCCCTCACCGTGTGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088431917 Original CRISPR CGCTTTAAGAGGGATGTGGA GGG (reversed) Intergenic
No off target data available for this crispr