ID: 1088432036

View in Genome Browser
Species Human (GRCh38)
Location 11:109769173-109769195
Sequence ACTCCCACACAAGTATAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088432036_1088432043 26 Left 1088432036 11:109769173-109769195 CCTAATTATACTTGTGTGGGAGT No data
Right 1088432043 11:109769222-109769244 GCAGAAGCAGAGTGATACAGGGG No data
1088432036_1088432044 30 Left 1088432036 11:109769173-109769195 CCTAATTATACTTGTGTGGGAGT No data
Right 1088432044 11:109769226-109769248 AAGCAGAGTGATACAGGGGTTGG No data
1088432036_1088432041 24 Left 1088432036 11:109769173-109769195 CCTAATTATACTTGTGTGGGAGT No data
Right 1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG No data
1088432036_1088432042 25 Left 1088432036 11:109769173-109769195 CCTAATTATACTTGTGTGGGAGT No data
Right 1088432042 11:109769221-109769243 TGCAGAAGCAGAGTGATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088432036 Original CRISPR ACTCCCACACAAGTATAATT AGG (reversed) Intergenic
No off target data available for this crispr