ID: 1088432039

View in Genome Browser
Species Human (GRCh38)
Location 11:109769208-109769230
Sequence TGCTTCTGCACACAGCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088432039_1088432042 -10 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432042 11:109769221-109769243 TGCAGAAGCAGAGTGATACAGGG No data
1088432039_1088432045 -2 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432045 11:109769229-109769251 CAGAGTGATACAGGGGTTGGAGG No data
1088432039_1088432043 -9 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432043 11:109769222-109769244 GCAGAAGCAGAGTGATACAGGGG No data
1088432039_1088432047 3 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432047 11:109769234-109769256 TGATACAGGGGTTGGAGGATGGG No data
1088432039_1088432044 -5 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432044 11:109769226-109769248 AAGCAGAGTGATACAGGGGTTGG No data
1088432039_1088432050 14 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432050 11:109769245-109769267 TTGGAGGATGGGTTTGGTCAGGG No data
1088432039_1088432049 13 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432049 11:109769244-109769266 GTTGGAGGATGGGTTTGGTCAGG No data
1088432039_1088432046 2 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432046 11:109769233-109769255 GTGATACAGGGGTTGGAGGATGG No data
1088432039_1088432048 8 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432048 11:109769239-109769261 CAGGGGTTGGAGGATGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088432039 Original CRISPR TGCTTCTGCACACAGCTGTA GGG (reversed) Intergenic
No off target data available for this crispr