ID: 1088432041

View in Genome Browser
Species Human (GRCh38)
Location 11:109769220-109769242
Sequence GTGCAGAAGCAGAGTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088432036_1088432041 24 Left 1088432036 11:109769173-109769195 CCTAATTATACTTGTGTGGGAGT No data
Right 1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088432041 Original CRISPR GTGCAGAAGCAGAGTGATAC AGG Intergenic
No off target data available for this crispr