ID: 1088432043

View in Genome Browser
Species Human (GRCh38)
Location 11:109769222-109769244
Sequence GCAGAAGCAGAGTGATACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088432039_1088432043 -9 Left 1088432039 11:109769208-109769230 CCCTACAGCTGTGTGCAGAAGCA No data
Right 1088432043 11:109769222-109769244 GCAGAAGCAGAGTGATACAGGGG No data
1088432040_1088432043 -10 Left 1088432040 11:109769209-109769231 CCTACAGCTGTGTGCAGAAGCAG No data
Right 1088432043 11:109769222-109769244 GCAGAAGCAGAGTGATACAGGGG No data
1088432036_1088432043 26 Left 1088432036 11:109769173-109769195 CCTAATTATACTTGTGTGGGAGT No data
Right 1088432043 11:109769222-109769244 GCAGAAGCAGAGTGATACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088432043 Original CRISPR GCAGAAGCAGAGTGATACAG GGG Intergenic
No off target data available for this crispr