ID: 1088435987

View in Genome Browser
Species Human (GRCh38)
Location 11:109813611-109813633
Sequence TAGATCATCTGGAAAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088435987_1088435991 6 Left 1088435987 11:109813611-109813633 CCTTCATCTTTCCAGATGATCTA No data
Right 1088435991 11:109813640-109813662 GAGAAAGAGAGAGGAAGAGGAGG No data
1088435987_1088435990 3 Left 1088435987 11:109813611-109813633 CCTTCATCTTTCCAGATGATCTA No data
Right 1088435990 11:109813637-109813659 TGAGAGAAAGAGAGAGGAAGAGG No data
1088435987_1088435989 -3 Left 1088435987 11:109813611-109813633 CCTTCATCTTTCCAGATGATCTA No data
Right 1088435989 11:109813631-109813653 CTAATATGAGAGAAAGAGAGAGG No data
1088435987_1088435992 9 Left 1088435987 11:109813611-109813633 CCTTCATCTTTCCAGATGATCTA No data
Right 1088435992 11:109813643-109813665 AAAGAGAGAGGAAGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088435987 Original CRISPR TAGATCATCTGGAAAGATGA AGG (reversed) Intergenic
No off target data available for this crispr