ID: 1088439771

View in Genome Browser
Species Human (GRCh38)
Location 11:109856936-109856958
Sequence AGAGTTGAAATGAAACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088439771_1088439775 6 Left 1088439771 11:109856936-109856958 CCAGATTGTTTCATTTCAACTCT No data
Right 1088439775 11:109856965-109856987 TATTGAGCTTTGGATGACACTGG No data
1088439771_1088439776 28 Left 1088439771 11:109856936-109856958 CCAGATTGTTTCATTTCAACTCT No data
Right 1088439776 11:109856987-109857009 GAATTTTCTGCCCAAAATATAGG No data
1088439771_1088439777 29 Left 1088439771 11:109856936-109856958 CCAGATTGTTTCATTTCAACTCT No data
Right 1088439777 11:109856988-109857010 AATTTTCTGCCCAAAATATAGGG No data
1088439771_1088439772 -4 Left 1088439771 11:109856936-109856958 CCAGATTGTTTCATTTCAACTCT No data
Right 1088439772 11:109856955-109856977 CTCTACCCATTATTGAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088439771 Original CRISPR AGAGTTGAAATGAAACAATC TGG (reversed) Intergenic
No off target data available for this crispr