ID: 1088440794

View in Genome Browser
Species Human (GRCh38)
Location 11:109867811-109867833
Sequence CCAAGGGGACAGAAGTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088440794_1088440800 -1 Left 1088440794 11:109867811-109867833 CCAATGGACTTCTGTCCCCTTGG No data
Right 1088440800 11:109867833-109867855 GTCACAGCTGCTACATGAGGTGG No data
1088440794_1088440799 -4 Left 1088440794 11:109867811-109867833 CCAATGGACTTCTGTCCCCTTGG No data
Right 1088440799 11:109867830-109867852 TTGGTCACAGCTGCTACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088440794 Original CRISPR CCAAGGGGACAGAAGTCCAT TGG (reversed) Intergenic
No off target data available for this crispr