ID: 1088440799

View in Genome Browser
Species Human (GRCh38)
Location 11:109867830-109867852
Sequence TTGGTCACAGCTGCTACATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088440790_1088440799 19 Left 1088440790 11:109867788-109867810 CCTCTATTTCAGATCCTGTAAGG No data
Right 1088440799 11:109867830-109867852 TTGGTCACAGCTGCTACATGAGG No data
1088440794_1088440799 -4 Left 1088440794 11:109867811-109867833 CCAATGGACTTCTGTCCCCTTGG No data
Right 1088440799 11:109867830-109867852 TTGGTCACAGCTGCTACATGAGG No data
1088440793_1088440799 5 Left 1088440793 11:109867802-109867824 CCTGTAAGGCCAATGGACTTCTG No data
Right 1088440799 11:109867830-109867852 TTGGTCACAGCTGCTACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088440799 Original CRISPR TTGGTCACAGCTGCTACATG AGG Intergenic