ID: 1088440800 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:109867833-109867855 |
Sequence | GTCACAGCTGCTACATGAGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1088440790_1088440800 | 22 | Left | 1088440790 | 11:109867788-109867810 | CCTCTATTTCAGATCCTGTAAGG | No data | ||
Right | 1088440800 | 11:109867833-109867855 | GTCACAGCTGCTACATGAGGTGG | No data | ||||
1088440793_1088440800 | 8 | Left | 1088440793 | 11:109867802-109867824 | CCTGTAAGGCCAATGGACTTCTG | No data | ||
Right | 1088440800 | 11:109867833-109867855 | GTCACAGCTGCTACATGAGGTGG | No data | ||||
1088440794_1088440800 | -1 | Left | 1088440794 | 11:109867811-109867833 | CCAATGGACTTCTGTCCCCTTGG | No data | ||
Right | 1088440800 | 11:109867833-109867855 | GTCACAGCTGCTACATGAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1088440800 | Original CRISPR | GTCACAGCTGCTACATGAGG TGG | Intergenic | ||