ID: 1088447030

View in Genome Browser
Species Human (GRCh38)
Location 11:109942272-109942294
Sequence ACCTAAGATACCCATAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088447030_1088447031 6 Left 1088447030 11:109942272-109942294 CCATAATTATGGGTATCTTAGGT No data
Right 1088447031 11:109942301-109942323 CTTCTACTGTTTTCATAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088447030 Original CRISPR ACCTAAGATACCCATAATTA TGG (reversed) Intergenic
No off target data available for this crispr