ID: 1088449352

View in Genome Browser
Species Human (GRCh38)
Location 11:109965340-109965362
Sequence AGTTATCTGTGGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088449352_1088449356 16 Left 1088449352 11:109965340-109965362 CCTGCCATCTTCCACAGATAACT No data
Right 1088449356 11:109965379-109965401 ACAGCTCTTGGCCTGTTACCAGG No data
1088449352_1088449358 25 Left 1088449352 11:109965340-109965362 CCTGCCATCTTCCACAGATAACT No data
Right 1088449358 11:109965388-109965410 GGCCTGTTACCAGGCTTTGGTGG No data
1088449352_1088449357 22 Left 1088449352 11:109965340-109965362 CCTGCCATCTTCCACAGATAACT No data
Right 1088449357 11:109965385-109965407 CTTGGCCTGTTACCAGGCTTTGG No data
1088449352_1088449355 4 Left 1088449352 11:109965340-109965362 CCTGCCATCTTCCACAGATAACT No data
Right 1088449355 11:109965367-109965389 TTCTTTTGAGAGACAGCTCTTGG 0: 15
1: 201
2: 219
3: 189
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088449352 Original CRISPR AGTTATCTGTGGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr