ID: 1088455602

View in Genome Browser
Species Human (GRCh38)
Location 11:110030034-110030056
Sequence CCTTGTGAACAAAAGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088455597_1088455602 30 Left 1088455597 11:110029981-110030003 CCACTGGATGTGTAAAAAATAAT No data
Right 1088455602 11:110030034-110030056 CCTTGTGAACAAAAGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088455602 Original CRISPR CCTTGTGAACAAAAGGAAAT GGG Intergenic
No off target data available for this crispr