ID: 1088460108

View in Genome Browser
Species Human (GRCh38)
Location 11:110073968-110073990
Sequence AACTCAGATGAATTTGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088460108_1088460111 11 Left 1088460108 11:110073968-110073990 CCAAAGTCAAATTCATCTGAGTT No data
Right 1088460111 11:110074002-110074024 TGTACCACTTAGTCACTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088460108 Original CRISPR AACTCAGATGAATTTGACTT TGG (reversed) Intergenic
No off target data available for this crispr