ID: 1088461831

View in Genome Browser
Species Human (GRCh38)
Location 11:110091468-110091490
Sequence GGCCTACTGACGTGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088461828_1088461831 8 Left 1088461828 11:110091437-110091459 CCTGCAATTTTATTTAATCGGCT No data
Right 1088461831 11:110091468-110091490 GGCCTACTGACGTGGAAAACAGG No data
1088461824_1088461831 20 Left 1088461824 11:110091425-110091447 CCTACCTGCCTACCTGCAATTTT No data
Right 1088461831 11:110091468-110091490 GGCCTACTGACGTGGAAAACAGG No data
1088461826_1088461831 12 Left 1088461826 11:110091433-110091455 CCTACCTGCAATTTTATTTAATC No data
Right 1088461831 11:110091468-110091490 GGCCTACTGACGTGGAAAACAGG No data
1088461825_1088461831 16 Left 1088461825 11:110091429-110091451 CCTGCCTACCTGCAATTTTATTT No data
Right 1088461831 11:110091468-110091490 GGCCTACTGACGTGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088461831 Original CRISPR GGCCTACTGACGTGGAAAAC AGG Intergenic
No off target data available for this crispr