ID: 1088466114

View in Genome Browser
Species Human (GRCh38)
Location 11:110140618-110140640
Sequence GGACTTGCCATGATAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088466114_1088466120 1 Left 1088466114 11:110140618-110140640 CCCTCCTTTATCATGGCAAGTCC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1088466120 11:110140642-110140664 ACCTTTTGGGTAGTGAACCCAGG 0: 1
1: 0
2: 2
3: 5
4: 66
1088466114_1088466122 8 Left 1088466114 11:110140618-110140640 CCCTCCTTTATCATGGCAAGTCC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1088466122 11:110140649-110140671 GGGTAGTGAACCCAGGTTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1088466114_1088466123 9 Left 1088466114 11:110140618-110140640 CCCTCCTTTATCATGGCAAGTCC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1088466123 11:110140650-110140672 GGTAGTGAACCCAGGTTTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088466114 Original CRISPR GGACTTGCCATGATAAAGGA GGG (reversed) Intronic
900089810 1:915104-915126 GGCCGTGCCCTGGTAAAGGAGGG + Intergenic
903312877 1:22473818-22473840 GGCCTTGGCATTATAGAGGAAGG + Intronic
904572828 1:31480015-31480037 GGACTTTCAATGGTAAAGCAAGG - Intergenic
905676884 1:39832522-39832544 GTACTTCCCATGCAAAAGGAAGG - Intergenic
909768215 1:79385528-79385550 GGAAATACCATGATAAAAGAAGG + Intergenic
910045803 1:82913891-82913913 GGAAATCCCATGATAAAGGTGGG - Intergenic
915637930 1:157199358-157199380 GGAACTGTCATAATAAAGGAAGG + Intergenic
915872555 1:159576533-159576555 GGACTTATGATGATAAAGGTGGG - Intergenic
919301820 1:195779788-195779810 TGACTTTCCATTGTAAAGGACGG + Intergenic
919855488 1:201703567-201703589 GGACTTGCCAAGGTCAAGGGTGG - Intronic
922550088 1:226488392-226488414 GGACCTGCCAGGAACAAGGAAGG - Intergenic
923798843 1:237186987-237187009 GGACTTGCCCTGACAAGTGAAGG + Intronic
1064370449 10:14748006-14748028 GGAATTGCCAGGGCAAAGGAGGG - Intronic
1069913661 10:71774420-71774442 GGATTTGCCGGGAAAAAGGAAGG - Intronic
1075910785 10:126123874-126123896 GGATTTTACATGTTAAAGGAAGG - Intronic
1087563760 11:99826368-99826390 GGACTTGCAAAGATGAAAGAAGG - Intronic
1088466114 11:110140618-110140640 GGACTTGCCATGATAAAGGAGGG - Intronic
1097273037 12:57790450-57790472 GAAGTTGCTATGAAAAAGGAAGG - Intronic
1099646692 12:85366675-85366697 GGTCTTGGGATGATAAAGGCTGG - Intergenic
1104219718 12:126770545-126770567 AGACTTAACATGATAAGGGAGGG + Intergenic
1106314374 13:28580114-28580136 GGACTTGGTAGGATATAGGATGG + Intergenic
1106946471 13:34833194-34833216 GGAGTGGCTATGATACAGGAAGG + Intergenic
1108456682 13:50622380-50622402 GGACTTCCCATTTTAAAAGAGGG - Intronic
1109700492 13:66018647-66018669 GGTCTTACCAGGATAAAGAAGGG - Intergenic
1115443678 14:33464773-33464795 GCACTTGGCATCATACAGGAAGG - Intronic
1116521265 14:45850015-45850037 GGGCTTTCCATGAAAAAGAAAGG + Intergenic
1117343541 14:54811478-54811500 GGACTTGAGATGATCAAAGAAGG + Intergenic
1121877930 14:97471072-97471094 GGAGATGCCATCATTAAGGAGGG + Intergenic
1128044246 15:64603576-64603598 TTACTTGTCATGATAAAGAAAGG - Intronic
1129623208 15:77168710-77168732 GGACTTGGAAGGGTAAAGGAAGG + Intronic
1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG + Intronic
1134375397 16:13667547-13667569 GGAATTTCCAGGTTAAAGGAAGG - Intergenic
1134384723 16:13760920-13760942 TGACTTGACGGGATAAAGGACGG - Intergenic
1138042577 16:53689559-53689581 TGCCTTGTCAGGATAAAGGATGG - Intronic
1138110321 16:54318695-54318717 GGACTAGCCAGGAGAAAGGCAGG + Intergenic
1138126348 16:54442105-54442127 GGACATGCCATATTAAAGTAAGG + Intergenic
1140882305 16:79209974-79209996 GGAGTGGGCATGATAATGGAGGG + Intronic
1141213831 16:82005683-82005705 GCACTTGCCATTATAAAGGCAGG - Intronic
1143986576 17:10919738-10919760 GGACTCAGCATGATAAAGGTTGG + Intergenic
1145732352 17:27200341-27200363 GGAATTCCCATGAAATAGGAAGG + Intergenic
1146227305 17:31078231-31078253 GGAATTCCCATGAAACAGGAAGG - Intergenic
1147654666 17:42082056-42082078 GGACTTGCCTGGAGAAAGGCGGG - Intergenic
1149215996 17:54355588-54355610 GGAATGGACATGATAAAAGAAGG - Intergenic
1151401601 17:73859253-73859275 GGACTTGTAATGAGAAAGTAAGG - Intergenic
1151402137 17:73862720-73862742 GGACTTGTAATGAGAAAGTAAGG + Intergenic
1157164823 18:45348890-45348912 TGACTAGCCATGTAAAAGGAAGG - Intronic
1157692232 18:49692823-49692845 GGTCTTGCTATGATAGATGAAGG - Intergenic
1158499362 18:57986143-57986165 GGACTGGGAATGATAGAGGATGG + Intergenic
1158524107 18:58197174-58197196 GGACTTGCCATGATAGAGCCTGG + Intronic
1158776689 18:60590923-60590945 GGACTAGGCATGAGGAAGGAAGG + Intergenic
1159870115 18:73751727-73751749 GGAGTTGCCCTGGTAAAGAAAGG + Intergenic
1163025724 19:14510594-14510616 GGACCTGCCAGAATAAAGGTGGG + Intergenic
1166569693 19:43785639-43785661 GGAGTTTCCAGGCTAAAGGAGGG + Intergenic
1168493190 19:56828381-56828403 GGAATTGCCAAGATAGGGGATGG - Intronic
926430442 2:12780059-12780081 GGACCTGCTATGAGACAGGATGG - Intergenic
927373339 2:22383296-22383318 AAACTTGCCTTGATGAAGGAAGG - Intergenic
929796922 2:45066894-45066916 GCACTTGGCATGATAAAGCATGG + Intergenic
934551720 2:95267006-95267028 GGAATAGGCATGAGAAAGGAGGG - Intergenic
938772259 2:134510732-134510754 GGGCTTGCCAAGCTTAAGGAAGG + Intronic
940642185 2:156356918-156356940 GGACTTTAAATTATAAAGGAGGG + Intergenic
943714189 2:191132556-191132578 GGAATTGCCATGATACAACAAGG + Intronic
943920064 2:193694974-193694996 GGACTTGGCATTTTAGAGGAGGG + Intergenic
944478903 2:200135091-200135113 GGGCTAGCCAAGAGAAAGGATGG + Intergenic
944665186 2:201953802-201953824 GGACTTGCCCTGGTAAGGCATGG - Intergenic
1172366726 20:34355710-34355732 GGACTAGCCCTGCTAAAGCAGGG - Intergenic
1173213124 20:41053238-41053260 GGAGTTGGCAAGACAAAGGAAGG - Intronic
1173550058 20:43926701-43926723 GGAATTGCAATGAGAAAGAAGGG - Intronic
1178090461 21:29157548-29157570 AGACTTCCCATCATAAAGAAGGG - Intronic
1178372225 21:32035935-32035957 GGGCTTGGGAAGATAAAGGAGGG + Intronic
1181294697 22:21827391-21827413 GAACTTGCCATGAGAAAGAAAGG + Intronic
1183793488 22:40095332-40095354 GGCCTTGCCACCATCAAGGATGG - Intronic
1184004627 22:41699250-41699272 GCATTTGCCTTGAAAAAGGAAGG - Intergenic
949167850 3:962366-962388 GGACCTCACATGAGAAAGGATGG + Intergenic
950329811 3:12147365-12147387 GGAGCTGCCATGGTTAAGGAGGG + Intronic
953505325 3:43480597-43480619 GAACCTGCCAAGATAAAGGAGGG + Intronic
955798478 3:62662147-62662169 GAGCTTGCCTTGAGAAAGGAGGG + Intronic
964720857 3:159765763-159765785 GGACCTGTCAGGATAAGGGAGGG + Intronic
966343923 3:178957139-178957161 GGACTTCCCAAAATAAAGGAAGG + Intergenic
968730847 4:2268570-2268592 GGACTTTCCATACTAAAGGCAGG - Intergenic
972417347 4:38854697-38854719 GGAATTGCTAAAATAAAGGAAGG - Intronic
974601279 4:64083937-64083959 GGTGTTGCTATGAAAAAGGAAGG - Intergenic
978237657 4:106478893-106478915 GGACTTGCCATGAAAGAAGTAGG - Intergenic
979652116 4:123147002-123147024 GGAGTTTCCAGTATAAAGGAAGG - Intronic
981585260 4:146294333-146294355 GCATTTGGCATGATTAAGGATGG - Intronic
983361057 4:166723826-166723848 GGAATTGGCAAGATAAAGGAGGG + Intergenic
990674715 5:58170749-58170771 GGACTGACCAAGATATAGGATGG + Intergenic
991254286 5:64597369-64597391 GGACGGTCCATGCTAAAGGAAGG + Intronic
992734415 5:79704467-79704489 TGACTTGCTTTGATGAAGGATGG - Intronic
994343990 5:98663671-98663693 GAACTTGCCACTCTAAAGGAAGG + Intergenic
994646421 5:102474756-102474778 GGACTTGGATTGATAAAAGAAGG + Intronic
994685601 5:102947514-102947536 GGACTTCCCAGGGTAAAGGATGG + Intronic
1000504158 5:162093161-162093183 GCATTTGCCATGATAAAGGGTGG + Intronic
1000973723 5:167741984-167742006 GGACTTGATATGACAAGGGATGG - Intronic
1001050275 5:168408507-168408529 AGCCTTGCCATGTTGAAGGACGG + Exonic
1001349207 5:170940635-170940657 AGACTTGCCATCATAATGGAAGG + Intronic
1008012768 6:46486436-46486458 GGACTTGGCATGAAAAAGCCTGG - Intronic
1008157356 6:48033189-48033211 GGATTTCCCATGATACTGGAAGG - Intronic
1013285678 6:108679419-108679441 GGACTTTCCATGCTAAAACAAGG - Intronic
1017165235 6:151401533-151401555 TGAATTGCCATTTTAAAGGAAGG - Intergenic
1017548892 6:155482893-155482915 GAACTTGGCATCATAAAGGATGG + Intergenic
1019905336 7:4057906-4057928 GGATTTGCTTTCATAAAGGAGGG - Intronic
1021342904 7:19487315-19487337 GTACGTCCCATGATAAAGCATGG + Intergenic
1026544451 7:71309694-71309716 GGAATTCCCATAATAAAGGGTGG + Intronic
1032324351 7:130913213-130913235 AAACCTGCCATTATAAAGGAGGG + Intergenic
1032874692 7:136025131-136025153 GGACTTGGCATCAGATAGGATGG + Intergenic
1034010954 7:147528980-147529002 CCACTTGCCATGATTAAAGATGG - Intronic
1034396197 7:150826631-150826653 GGCATTCCCATGATAAGGGAGGG + Intronic
1040593031 8:48813475-48813497 AGGCTTGCCATGATGATGGAAGG + Intergenic
1043674400 8:82932298-82932320 GGATTTATCATGATAAAAGATGG - Intergenic
1044249452 8:89988954-89988976 GAACTGGGCCTGATAAAGGAAGG - Intronic
1048849524 8:138631074-138631096 GAACTTCCCATCATAGAGGAAGG - Intronic
1049096644 8:140552096-140552118 GGCCTTGCCATGCTACAGGAAGG + Intronic
1049817718 8:144615547-144615569 GGAATAGCCATGGCAAAGGAGGG - Intergenic
1051322873 9:15928342-15928364 GGAGTTGACATGAGAAAGCATGG + Intronic
1060221831 9:121768248-121768270 GGACTTACCATGAGCAAGGAGGG + Intronic
1186916797 X:14231504-14231526 TGACTTGGCATGAGAAAGGTGGG + Intergenic
1189367063 X:40396991-40397013 GGACCTGCCATGAGAGGGGAGGG + Intergenic
1189597572 X:42585563-42585585 GGACTCAGCATGATAATGGAAGG + Intergenic
1191730424 X:64328731-64328753 GGACCTGCTATAAGAAAGGAGGG + Intronic
1196192920 X:112813230-112813252 GGACTTGCCCTTTTGAAGGATGG - Intronic
1197808152 X:130416769-130416791 GTACTGGCCCTAATAAAGGAGGG - Intergenic
1199019521 X:142860832-142860854 GGAATTGACATGATAGATGAGGG + Intergenic
1200063814 X:153495485-153495507 GGACTTGCAATGATGAAACAGGG - Intronic
1200809909 Y:7473550-7473572 GGTCTTACCATTTTAAAGGAAGG + Intergenic
1202338681 Y:23837052-23837074 GGACATGCCCTGATAACTGAGGG + Intergenic
1202532085 Y:25833020-25833042 GGACATGCCCTGATAACTGAGGG - Intergenic