ID: 1088470550

View in Genome Browser
Species Human (GRCh38)
Location 11:110184399-110184421
Sequence GACCTGGATTTCCCTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088470550_1088470558 27 Left 1088470550 11:110184399-110184421 CCTGGTGTAGGGAAATCCAGGTC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1088470558 11:110184449-110184471 CCCCAAATGAACAGAGAGCAAGG 0: 1
1: 0
2: 0
3: 40
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088470550 Original CRISPR GACCTGGATTTCCCTACACC AGG (reversed) Intronic
900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG + Intronic
915375773 1:155393905-155393927 TCCCTGGATTTCCCAGCACCTGG - Intronic
917716745 1:177745891-177745913 GACCTGGATTCCCGAACACTTGG - Intergenic
919049004 1:192489261-192489283 GACCTAGAATTCCCCACATCTGG + Intergenic
924856965 1:247883510-247883532 CACTTGGATTTCCTTACGCCTGG + Intergenic
1064121219 10:12621936-12621958 AACCTGGGTTTCACTCCACCTGG - Intronic
1064385477 10:14887323-14887345 AACCTGTATTTTCCTAGACCTGG - Intronic
1066701811 10:38137574-38137596 GACCTGGCCTTCCAAACACCAGG - Intergenic
1068956583 10:62823928-62823950 TACCTGGATTGCCCTGCATCTGG - Intronic
1069904153 10:71722630-71722652 GTCCTGGCCTTCCCTACCCCTGG - Intronic
1074124508 10:110517413-110517435 GACCAGGGTTTCCCAACCCCTGG + Intergenic
1074489586 10:113927233-113927255 GACTGGGCTTTCTCTACACCTGG - Intergenic
1079394421 11:20049674-20049696 GCCCTGGATTTCTCTGCAGCAGG + Intronic
1080376473 11:31718677-31718699 GACCTGGACTTCCTCACACATGG + Intronic
1081855367 11:46300052-46300074 GAACTGGACTCCCCTACGCCAGG + Exonic
1081925690 11:46826515-46826537 GACCTGGCTTTGCCCCCACCTGG - Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1088539397 11:110897431-110897453 GACCTGTAGTCCCCTCCACCTGG + Intergenic
1090510659 11:127371248-127371270 GATCTGAATCTCCCTACACATGG - Intergenic
1092282030 12:7105014-7105036 GAGCTGCATCTCCCTCCACCAGG + Intronic
1093687414 12:22072376-22072398 GTCTTGCATTTCCCTACACAGGG + Intronic
1096799205 12:54098263-54098285 GGCCTGGAGTTCCCTGCAACGGG - Intergenic
1097910519 12:64965144-64965166 GCCTTGGATTTCCCCATACCTGG + Intergenic
1099119622 12:78672153-78672175 GGCCTGGATTTCCCCAGACCTGG + Intergenic
1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG + Intronic
1110324809 13:74201692-74201714 AGCCTGGATTTCCCAACTCCTGG - Intergenic
1118497470 14:66322554-66322576 TACCTGGCTTACCTTACACCAGG - Intergenic
1125045019 15:35235230-35235252 GAACTGGACTTTCCTACCCCTGG - Intronic
1125360939 15:38864352-38864374 GACCTGGAGCTACCCACACCAGG - Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1128537758 15:68503540-68503562 GACCTGGATTTTCCTCCCTCTGG + Intergenic
1128706736 15:69842343-69842365 GACCTGGCTTTCCCTGCCACCGG - Intergenic
1131659335 15:94497489-94497511 GACCTGGATTTCCGAACTACTGG - Intergenic
1139225278 16:65228491-65228513 TTCCAAGATTTCCCTACACCTGG - Intergenic
1140797559 16:78453962-78453984 GATCTGGATTTCACCACACCTGG + Intronic
1147498140 17:40937150-40937172 GAGCTGGCTTTCCCTTCTCCAGG - Intronic
1151943460 17:77306684-77306706 AATCAGGGTTTCCCTACACCAGG - Intronic
1157700612 18:49759729-49759751 GGCCTGGATTTCCCAGCACAAGG - Intergenic
1157753151 18:50195530-50195552 GACCTGGATATACATACACCAGG + Intergenic
1157818897 18:50751140-50751162 GACCTGGATCTCCCGTCTCCTGG - Intergenic
1159084615 18:63774573-63774595 AACCTACCTTTCCCTACACCTGG + Intronic
1167693751 19:51002304-51002326 GACCTGGTTTCCCCTTCCCCTGG + Intronic
929998579 2:46845807-46845829 TCCCAGGATTTCCCTACCCCGGG - Intronic
932268743 2:70390506-70390528 GACCTGGCTTACCCCACCCCAGG + Intergenic
935867520 2:107406584-107406606 GAACTGAAATTCCCTTCACCTGG - Intergenic
943914243 2:193607626-193607648 CACCTGGAATACCCTACAGCAGG - Intergenic
947098241 2:226591354-226591376 GCCTTGGTTTTCCCTATACCTGG + Intergenic
948152785 2:235757502-235757524 GACATGGATCTGCCTAGACCAGG - Intronic
1171797217 20:29576083-29576105 GGCCTGGAGTTCCCTGCAACGGG + Intergenic
1171851035 20:30308078-30308100 GGCCTGGAGTTCCCTGCAACAGG - Intergenic
1173144793 20:40515250-40515272 CACCTGCTTTTCCCTGCACCTGG + Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1178792801 21:35715447-35715469 GATCTGGACATCTCTACACCTGG + Intronic
1179427723 21:41295229-41295251 TACCTCAATTTTCCTACACCTGG - Intergenic
1179832351 21:44005190-44005212 GGACTGGCTTTCCCTGCACCCGG + Intergenic
1182067470 22:27441020-27441042 GACCTGGATTTCGCTAAATTGGG + Intergenic
950427391 3:12931792-12931814 GACCTGGCCTCCCCTACACTCGG - Intronic
952885403 3:38008612-38008634 GCCCTGAATTTCCAGACACCTGG - Exonic
960369627 3:116817791-116817813 GCCCTACATTTCCCTGCACCTGG - Intronic
963458499 3:145577107-145577129 AACCTGGATAGCCCTACATCAGG - Intergenic
969116385 4:4872970-4872992 GCCCTGGATTTCCTGACAGCCGG + Intergenic
971000185 4:22313713-22313735 AACCTGGATTTCTCCATACCAGG + Intergenic
973596442 4:52495660-52495682 GAACTTGAATTCCCAACACCTGG + Intergenic
974332824 4:60502142-60502164 GTCCTGAATTTCTCTATACCAGG - Intergenic
976184674 4:82431378-82431400 AACCTTGATTGCCCGACACCAGG - Intronic
980846372 4:138330008-138330030 GACATGCATTTGCCTACAGCTGG + Intergenic
981050368 4:140303738-140303760 GAGCTCCATTTCCCTATACCTGG - Intronic
981186652 4:141811437-141811459 TACCTGGTTTTCCCCACACTTGG + Intergenic
982589164 4:157282508-157282530 GACATGGATTTCCGAAGACCTGG + Intronic
985173958 4:187181333-187181355 GCCGTGGATCTCCCTTCACCTGG - Intergenic
986286193 5:6360826-6360848 GGCCTGGATTTCCATTCACTGGG - Intergenic
996491549 5:124104072-124104094 GACCTTGATTTCCATAATCCAGG + Intergenic
1002476472 5:179469210-179469232 AACGTGGCTTTCCCTACAACGGG - Intergenic
1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG + Intronic
1006930414 6:37684492-37684514 GTCCTGGATTCCCCTAAGCCTGG + Intronic
1010760262 6:79714476-79714498 CACCTGGGGTTCCCTTCACCTGG + Intergenic
1015310459 6:131761659-131761681 CTCCTGGATTTCCTTACACGTGG + Intergenic
1015457709 6:133446626-133446648 GTCCTGCATTTCCATAGACCTGG - Exonic
1016388468 6:143551541-143551563 GAGCTGGGTTTCTCAACACCCGG + Intronic
1020285874 7:6680152-6680174 TACCTGGATTTCCTTGCAGCAGG + Intergenic
1022992658 7:35724145-35724167 GACCTGGATATCCCGATTCCGGG - Intergenic
1024087831 7:45911385-45911407 GTCCTGGATTTCCAGACACTTGG + Intergenic
1034999718 7:155603163-155603185 GACATGTATTTCCCTCCCCCAGG - Intergenic
1035057671 7:156046770-156046792 CACCTGCATTTCCCCACAGCTGG - Intergenic
1037487235 8:19358969-19358991 CACCTGGATTTCCCCATGCCTGG + Intronic
1039471088 8:37814275-37814297 GGCCTGGCTTCCCCTACACTCGG + Intronic
1041401980 8:57455965-57455987 AACCTGGCTTTGCCTACTCCTGG + Intergenic
1059079365 9:111232309-111232331 GACCAGGAGTTCCCCACCCCTGG + Intergenic
1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG + Intergenic
1061857887 9:133452935-133452957 GCCCTGGATATCCCTCCCCCAGG + Intronic
1187779055 X:22796655-22796677 GAAGTTGATTTCCCTACTCCTGG + Intergenic
1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG + Intergenic
1196809243 X:119615519-119615541 GGCCTGAAATTCCCAACACCTGG - Intergenic
1201054616 Y:9976164-9976186 GACTTGGATGTCTCAACACCTGG + Intergenic