ID: 1088470558

View in Genome Browser
Species Human (GRCh38)
Location 11:110184449-110184471
Sequence CCCCAAATGAACAGAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 329}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088470548_1088470558 30 Left 1088470548 11:110184396-110184418 CCTCCTGGTGTAGGGAAATCCAG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1088470558 11:110184449-110184471 CCCCAAATGAACAGAGAGCAAGG 0: 1
1: 0
2: 0
3: 40
4: 329
1088470554_1088470558 5 Left 1088470554 11:110184421-110184443 CCCTGAGGGACTGTGCAGAACAA 0: 1
1: 0
2: 2
3: 25
4: 233
Right 1088470558 11:110184449-110184471 CCCCAAATGAACAGAGAGCAAGG 0: 1
1: 0
2: 0
3: 40
4: 329
1088470553_1088470558 11 Left 1088470553 11:110184415-110184437 CCAGGTCCCTGAGGGACTGTGCA 0: 1
1: 1
2: 1
3: 21
4: 210
Right 1088470558 11:110184449-110184471 CCCCAAATGAACAGAGAGCAAGG 0: 1
1: 0
2: 0
3: 40
4: 329
1088470550_1088470558 27 Left 1088470550 11:110184399-110184421 CCTGGTGTAGGGAAATCCAGGTC 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1088470558 11:110184449-110184471 CCCCAAATGAACAGAGAGCAAGG 0: 1
1: 0
2: 0
3: 40
4: 329
1088470555_1088470558 4 Left 1088470555 11:110184422-110184444 CCTGAGGGACTGTGCAGAACAAG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 1088470558 11:110184449-110184471 CCCCAAATGAACAGAGAGCAAGG 0: 1
1: 0
2: 0
3: 40
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088470558 Original CRISPR CCCCAAATGAACAGAGAGCA AGG Intronic
900277576 1:1841855-1841877 TCCCAAAAGAACTGAAAGCAGGG + Intronic
900899788 1:5508757-5508779 CCCTAAACGGACAGAGAGCAGGG - Intergenic
901624137 1:10614015-10614037 CCGCAAGGGAACTGAGAGCAGGG - Intronic
901628551 1:10637359-10637381 CCCGAACTGGACAGGGAGCAGGG - Exonic
902732524 1:18378607-18378629 TCCCAAATGAACAGTGGACATGG + Intergenic
903137193 1:21317389-21317411 CCCAAAATGAACAGACAGAGGGG + Intronic
903254408 1:22084159-22084181 CCCCAAAAGAACTGAAAGCAGGG - Intronic
904908198 1:33913798-33913820 CCCCAGATTAAAAGAGAGGAGGG - Intronic
905038294 1:34930830-34930852 CCACAAGGAAACAGAGAGCAGGG - Intergenic
905253577 1:36665601-36665623 CCCAGAATGACCAGAGTGCAGGG - Intergenic
906501415 1:46343761-46343783 CCCCAAATTAGCAGAGGTCAGGG + Intronic
907057622 1:51385562-51385584 ACCCAAAAGAACTGAAAGCAGGG + Intronic
907131311 1:52099884-52099906 CACCAAATGATCTTAGAGCAAGG + Intergenic
909367706 1:74847026-74847048 ACCCAAAAGAATTGAGAGCAGGG + Intergenic
910813884 1:91267543-91267565 CCCCCTAAGAACAGAGATCAAGG - Intronic
913587232 1:120287581-120287603 TCCCAAATGAATAGAGTGGATGG + Intergenic
913620953 1:120610788-120610810 TCCCAAATGAATAGAGTGGATGG - Intergenic
914569248 1:148899464-148899486 TCCCAAATGAATAGAGTGGATGG + Intronic
914603579 1:149230792-149230814 TCCCAAATGAATAGAGTGGATGG - Intergenic
917721651 1:177791734-177791756 CCCCAAGTGCACAGAGAGAAAGG + Intergenic
918092382 1:181308578-181308600 CCCCAAAAGAATGGAAAGCAGGG + Intergenic
918211633 1:182356749-182356771 GCCCAAATATAGAGAGAGCATGG + Intergenic
919571024 1:199247663-199247685 CCCCAAATGGAGAGAGGTCATGG + Intergenic
919858564 1:201722585-201722607 CCCAAAAAGAACCGAAAGCAGGG - Intronic
920061072 1:203227313-203227335 CCCCAAAGGAAAAGAAAGGAAGG + Intronic
920406503 1:205717183-205717205 CCCCAAATAAAAGCAGAGCATGG + Exonic
922146196 1:222947535-222947557 ACCCAAAAGAACTGAAAGCAGGG - Intronic
922773439 1:228202513-228202535 ACCCAAAAGAACTGAAAGCAGGG - Intergenic
923071576 1:230569968-230569990 ACCCAAAAGAACTGAAAGCAGGG - Intergenic
923547524 1:234933657-234933679 CCCCACATAACCAGAGACCATGG + Intergenic
923556655 1:235006174-235006196 ACCCAAAAGAACTGAAAGCAGGG + Intergenic
924719801 1:246611734-246611756 ACCCAAAAGAATAGAAAGCAAGG + Intronic
1063962966 10:11322259-11322281 CCCCAATTAAACAAAGACCAAGG - Intronic
1064129001 10:12690978-12691000 CCCCCAGTCAACAGAGAGAAAGG - Intronic
1066484677 10:35831942-35831964 ACCCAAATGAATTGAAAGCAGGG - Intergenic
1067305275 10:45058505-45058527 CCCCAAATGAGTTGAAAGCAGGG - Intergenic
1069719872 10:70542758-70542780 GCCCAAAAGAACTGAAAGCAGGG - Intronic
1070608517 10:77916766-77916788 ACCCAAAAGAAGAGAAAGCAGGG + Intronic
1070704322 10:78626749-78626771 CCCCACATGAACCGTGAGCCTGG + Intergenic
1071029689 10:81161861-81161883 ACACAAATGAACAGAGAGTGGGG + Intergenic
1074452297 10:113568960-113568982 GCCCTACTGAACAGAGACCATGG + Intronic
1074547317 10:114411189-114411211 TCCCAAAAGAACTGAAAGCAAGG - Intergenic
1075187183 10:120273690-120273712 CCCCTAATTAATAGAGAGGATGG - Intergenic
1077295559 11:1824872-1824894 CCCCAAAGGAGCTCAGAGCAGGG - Intergenic
1077349325 11:2084993-2085015 CCCCAGGAGAACACAGAGCAGGG + Intergenic
1079376209 11:19894400-19894422 CCCCAAATGAGTATAGGGCAAGG - Intronic
1081655442 11:44854171-44854193 GCCCCAATGAGCAGAGACCAAGG - Intronic
1083776343 11:64895940-64895962 CCCCAACAGGACAGAGGGCAGGG - Intronic
1083844894 11:65325809-65325831 ACCCAAACGAACTGAAAGCAAGG - Intergenic
1084090939 11:66879079-66879101 TCCCAGATGAACAGAGGGCCAGG + Intronic
1085753428 11:79184010-79184032 ACCCAAAAGAACTGAGAGCAGGG + Intronic
1087832266 11:102832062-102832084 CCCAAAATGAACAGAGTGCCTGG + Intergenic
1088470558 11:110184449-110184471 CCCCAAATGAACAGAGAGCAAGG + Intronic
1088533842 11:110838641-110838663 CTCTAAAAGAACAGAGAGAAGGG - Intergenic
1089126328 11:116179042-116179064 ACCCAAAGGAACAAAGAGAAGGG + Intergenic
1089277639 11:117349410-117349432 ACCCAAATGAATTGAAAGCAGGG - Intronic
1089445250 11:118546827-118546849 CACCATATGAACAGAGAAAATGG + Intronic
1090134566 11:124183795-124183817 TTCAGAATGAACAGAGAGCATGG + Intergenic
1090341131 11:126021536-126021558 CCCCATATGCAAAGAAAGCAGGG + Intronic
1091818754 12:3458840-3458862 CCCCAGGTGAACAGACAGGAAGG - Intronic
1092826836 12:12408285-12408307 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1093426075 12:19030901-19030923 CACCCAAAGAACAGAGAGCTAGG + Intergenic
1096215092 12:49794086-49794108 CCCCAGAGGAACAGAGGGCAGGG + Intronic
1097661870 12:62438834-62438856 ACCCAAAAGATCAGAGAGCAAGG - Intergenic
1100400934 12:94228889-94228911 ACCGAAAAGAACTGAGAGCAGGG - Intronic
1101419903 12:104542259-104542281 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1102029529 12:109731879-109731901 TCCCACCTGAACAGAGAGCTGGG - Intronic
1102924692 12:116817907-116817929 CCCCCAATGAAATGAGAGCAGGG - Intronic
1104094316 12:125542821-125542843 ACTCAAAAGAACAGAAAGCAAGG - Intronic
1105830029 13:24156168-24156190 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1105948779 13:25211606-25211628 CCCCAAATAAGCAGAGAGACAGG + Intergenic
1107435002 13:40374267-40374289 CCCCAAAGGGAAACAGAGCAAGG + Intergenic
1110537080 13:76663608-76663630 TGCCAAATGAACACAGAGGAGGG + Intergenic
1115365815 14:32555928-32555950 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1115418752 14:33168082-33168104 TCCCAAATGCTCAGAGAGCCCGG - Intronic
1115993314 14:39171434-39171456 CCCCAAATTAACATACCGCAAGG + Intergenic
1116417125 14:44691990-44692012 ATCCAAATGAACTGAAAGCAGGG - Intergenic
1117210446 14:53492770-53492792 ACCCAAAAGAACTGAAAGCAGGG - Intergenic
1117345122 14:54824111-54824133 CCCCAGAAGAAGAGAGAGAAAGG + Intergenic
1120187991 14:81414445-81414467 CGCCAAATGGACAGAGAAGATGG + Intronic
1120842277 14:89096382-89096404 CAGCAAATGAACTGAAAGCATGG - Intergenic
1121070321 14:91013507-91013529 CACCAAAACAACAGAGAACATGG + Intronic
1121626710 14:95390456-95390478 CACCAAATGTCCATAGAGCAGGG + Intergenic
1121985653 14:98502849-98502871 CCCCAACTGGAGAGACAGCAGGG + Intergenic
1122073433 14:99220248-99220270 CTCCAAAAGAACTGAAAGCAAGG + Intronic
1124224023 15:27873583-27873605 CCCCACATGCACACAGAGTATGG + Intronic
1124427803 15:29577281-29577303 ACCCAAATGAATTGAAAGCAGGG + Intergenic
1124835000 15:33187951-33187973 GGCCAAATTCACAGAGAGCAAGG - Intronic
1125867060 15:43062144-43062166 ACCCAAAAGAACTGAAAGCAAGG + Intronic
1125988441 15:44079615-44079637 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1126326552 15:47484121-47484143 GCCAAAAGGAACAGAGAGAAGGG - Intronic
1127848122 15:62889229-62889251 CACAAAATGAGCATAGAGCATGG + Intergenic
1128147702 15:65341383-65341405 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1128761758 15:70221058-70221080 CCCCAGATAAGCAGAGACCAAGG - Intergenic
1129526535 15:76219985-76220007 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1130338845 15:82981516-82981538 ACCCAAAAGAATAGAAAGCAGGG + Intronic
1130717650 15:86351454-86351476 GCCCACATGAAGAGAAAGCATGG + Intronic
1131988976 15:98074343-98074365 ACACAAATGAAAAAAGAGCAGGG - Intergenic
1132899647 16:2246298-2246320 CCACAGAGGATCAGAGAGCATGG + Intronic
1132982171 16:2743867-2743889 CCCCAAAGAAACAGAGTGAAGGG + Intergenic
1134239787 16:12497023-12497045 GCCCAAGTGAACAGGTAGCATGG + Intronic
1134268322 16:12710989-12711011 CCCCAAAATAACTGAAAGCAGGG + Intronic
1134774380 16:16839066-16839088 CACAAAATGAACTGAGAGAAGGG - Intergenic
1137306195 16:47203005-47203027 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1137646373 16:50078200-50078222 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1138571736 16:57878602-57878624 GCAAAAAAGAACAGAGAGCAGGG + Intergenic
1139550444 16:67669861-67669883 CCCCACATGCACAGAGTGAAGGG - Intergenic
1139905822 16:70365146-70365168 CGACAACTGAACAGTGAGCAGGG + Intronic
1140241038 16:73201029-73201051 AACCAAATGAACTGAGAGCAGGG - Intergenic
1140358828 16:74328051-74328073 CCCCAAAAGAACTGAAAGCAAGG + Intergenic
1140691619 16:77490010-77490032 CCCTAAATGACTAGAGAGGAAGG + Intergenic
1141949241 16:87330128-87330150 CTCCTGAAGAACAGAGAGCACGG - Exonic
1143930346 17:10416439-10416461 CCCCAAAAGAACTGGAAGCAGGG - Intronic
1144054399 17:11526116-11526138 CACCAAATCAGCAGAGAGCGGGG - Intronic
1144348103 17:14368133-14368155 ACCCAAAAGAACGGAAAGCAAGG - Intergenic
1144798485 17:17909255-17909277 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1145038294 17:19556526-19556548 CCCCAAAACAACTGAAAGCAGGG + Intronic
1145059843 17:19725548-19725570 ACCCAAAAGAACTGAAAGCAGGG + Intergenic
1145718731 17:27048740-27048762 ACCCAAAAGAATTGAGAGCAAGG + Intergenic
1146547338 17:33750302-33750324 CCTTAAATGAACAGATTGCAAGG + Intronic
1147381344 17:40058084-40058106 CCCCAGATAGACAGAAAGCAGGG - Intronic
1148078664 17:44955234-44955256 GCACAAATGAATGGAGAGCATGG + Intergenic
1148709544 17:49667752-49667774 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1148931368 17:51129887-51129909 CCCCAAATGAGAAGAGGGTAGGG + Intergenic
1151366541 17:73620531-73620553 ACCCAAAAGAACTGAGAACAAGG + Intronic
1152154265 17:78622660-78622682 CCCCACAGGAAGGGAGAGCACGG + Intergenic
1152583010 17:81176764-81176786 TCCCAAAAGAACTGAAAGCAGGG + Intergenic
1152934940 17:83131080-83131102 CCACAAGAGCACAGAGAGCATGG - Intergenic
1153459050 18:5313548-5313570 TCCCAAATGCACACAGAGGATGG - Intergenic
1154319927 18:13340254-13340276 CCTCAAAAGAACTGAAAGCAAGG - Intronic
1154470416 18:14694643-14694665 ACCCAAAAGAACTGAGAGCAAGG - Intergenic
1155406203 18:25490641-25490663 CCCCCAAGCTACAGAGAGCATGG + Intergenic
1155551741 18:26972495-26972517 CCCTAAAGGGAGAGAGAGCATGG + Intronic
1156351267 18:36303336-36303358 CCCCATCTGCACAGAGAGCATGG - Intronic
1158438934 18:57456241-57456263 CTCCAAAAGAACTGAAAGCAGGG + Intronic
1158545647 18:58394168-58394190 CCCGGAATGAACAGAGTGCTTGG - Intronic
1159575964 18:70177937-70177959 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1160128612 18:76204188-76204210 CCCCAAATGCACACAATGCAGGG - Intergenic
1161935676 19:7370580-7370602 TCCCAGAAGAACTGAGAGCAAGG + Intronic
1163325831 19:16602497-16602519 ACCCAAAAGAACCGAAAGCAGGG + Intronic
1163651245 19:18519428-18519450 ACCCAAAACCACAGAGAGCACGG + Intronic
1164170618 19:22721730-22721752 CCACACATGGACAGAGACCACGG - Intergenic
1164515004 19:28926708-28926730 CCCCAAAAGAAAAGAGACAATGG + Intergenic
1165216651 19:34279123-34279145 ACCCAAAAGAACTGAAAGCAAGG - Intronic
1165335986 19:35169883-35169905 TCCCAAATGATCAGAGATCCTGG - Intronic
1165553804 19:36611632-36611654 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1202646769 1_KI270706v1_random:149151-149173 ACCCAAAAGAACTGAGAGCAGGG + Intergenic
927824004 2:26294761-26294783 ACCCAAAAGAACTGAAAGCAGGG + Intergenic
928877038 2:36052330-36052352 CCCCTAATGAACACCGAGGAAGG - Intergenic
929041529 2:37749387-37749409 CACCAAATGTCCTGAGAGCATGG - Intergenic
929761674 2:44812239-44812261 ACCCAAAAGAACAGAAAACAGGG - Intergenic
929798921 2:45082841-45082863 CCTCAAATGAACAGACAACAGGG - Intergenic
930015479 2:46967746-46967768 ACCCAAAAGAATAGAAAGCAGGG - Intronic
932176970 2:69611650-69611672 ACCCAAAAGAACAGAATGCAGGG + Intronic
932219389 2:69988169-69988191 ACCCAAAAGAACTGAAAGCAGGG + Intergenic
934509932 2:94929578-94929600 ACCCAAAATAACTGAGAGCAGGG + Intergenic
934730598 2:96654187-96654209 CCCCAAGTCAACACAAAGCAAGG - Intergenic
935215267 2:100970912-100970934 CACCACCTGAACAGACAGCAAGG - Intronic
935240927 2:101177656-101177678 CACCAAATGAACAGATGGGAGGG + Intronic
935611250 2:105027815-105027837 ACCCCAAAGAACAGAAAGCAGGG + Intergenic
935873745 2:107483096-107483118 CCCCAAATGAGAAGAGAAAATGG - Intergenic
936669194 2:114636712-114636734 CCCCAAATTCTCAGGGAGCATGG - Intronic
937246675 2:120498537-120498559 CCCCAACTCAGCAGTGAGCAGGG + Intergenic
937358849 2:121214969-121214991 ACCCAAAAGAACTGAAAGCAGGG + Intergenic
937707943 2:124942863-124942885 CCCAAAGTGGACAGAGGGCAGGG - Intergenic
938220105 2:129559127-129559149 CCACAACTAAACTGAGAGCACGG - Intergenic
938338607 2:130520755-130520777 CCCCACGTGAAAAGAGAGAAAGG - Intergenic
938351233 2:130599995-130600017 CCCCACGTGAAAAGAGAGAAAGG + Intergenic
941085697 2:161115052-161115074 CCTCAACTGGAAAGAGAGCAAGG + Intergenic
941377783 2:164752591-164752613 GCCCAAAAGCACAGAGAGCATGG + Intronic
944208752 2:197184681-197184703 CCCCAAAGGGAAAAAGAGCATGG - Intronic
944452017 2:199852851-199852873 ACCCAAATGGAGAGAAAGCAGGG + Intergenic
945035795 2:205702970-205702992 CCACATATGAACAAAAAGCAAGG - Intronic
945315164 2:208362659-208362681 ACCCAAAAGAACTCAGAGCAGGG - Intronic
946386104 2:219385481-219385503 CCCCAGATGGGCACAGAGCAGGG + Exonic
947120195 2:226805944-226805966 TGCCAAGTGAATAGAGAGCACGG - Intergenic
947568468 2:231211588-231211610 ATCCAAAAGAACAGAAAGCAAGG - Intronic
948049804 2:234971476-234971498 ACCCAAAAGAGCTGAGAGCAGGG - Intronic
948486603 2:238285298-238285320 CACCACAAGAACAGAGAGCCTGG + Intronic
948550705 2:238771302-238771324 ACCCAAAGGAACAAAAAGCAGGG + Intergenic
948640689 2:239374363-239374385 CCCCAGATGAATAGAAAACAAGG + Intronic
1169347744 20:4842250-4842272 ACCCAAAAGAACTGAAAGCAGGG - Intergenic
1169387240 20:5161037-5161059 ACCCAAAAGAACTGAGGGCAGGG - Intronic
1169636171 20:7694295-7694317 CCCAAATGGAACAGAGGGCATGG - Intergenic
1169833211 20:9848537-9848559 ACCCAAAAGAACTGAAAGCAAGG + Intergenic
1170957632 20:20995889-20995911 CCCCACATTAACAGGGAGCTTGG - Intergenic
1172643689 20:36456855-36456877 CCCCAAAGGAAGAGAGATGAAGG + Intronic
1173032423 20:39374306-39374328 ACCCCAAAGAACAGAGAGAAGGG - Intergenic
1174342622 20:49907423-49907445 CTCCATATGAAGAGAGAGCCTGG + Intronic
1174535242 20:51246420-51246442 CCCCACATGAGCACAGAGAAAGG + Intergenic
1174970565 20:55270794-55270816 CTCCTAATGAGCAGAGAGAATGG - Intergenic
1176042977 20:63075420-63075442 CCCCAAAAGAATTGAAAGCAGGG - Intergenic
1176605096 21:8823624-8823646 ACCCAAAAGAACTGAGAGCAGGG - Intergenic
1176804071 21:13463224-13463246 ACCCAAAAGAACTGAGAGCAAGG + Intergenic
1177068935 21:16477563-16477585 CCCCAAAACAACTGAGAACATGG + Intergenic
1178501857 21:33132174-33132196 ACCCAAAAGAATAGAAAGCAAGG + Intergenic
1178941712 21:36912139-36912161 ACCCAAAAGAACTGACAGCAGGG + Intronic
1179416895 21:41205935-41205957 CCCCCAAAGAACTGAAAGCAGGG + Intronic
1179817130 21:43913739-43913761 CATCAAATGCACAGAGACCAGGG + Intronic
1179987224 21:44928577-44928599 GGCCAACTGACCAGAGAGCAGGG + Intronic
1180195604 21:46191787-46191809 CCCAAAAAGGACACAGAGCAGGG + Intronic
1180347388 22:11715229-11715251 ACCCAAAAGAACTGAGAGCAGGG - Intergenic
1180355149 22:11833333-11833355 ACCCAAAAGAACTGAGAGCAGGG - Intergenic
1180383102 22:12158998-12159020 ACCCAAAAGAACTGAGAGCAGGG + Intergenic
1181088554 22:20456666-20456688 CCCCAAAGAAGCTGAGAGCAAGG + Intronic
1181533888 22:23532016-23532038 CTGGAAATGCACAGAGAGCAGGG + Intergenic
1183897286 22:40979418-40979440 ACCCAAAAGAACTGAAAGCAGGG - Intergenic
1184891613 22:47382819-47382841 CCCCAAATGGGCAGAGCTCAGGG + Intergenic
1184900484 22:47443791-47443813 CCCCAACTGCACAGAGAAAAGGG - Intergenic
1185209701 22:49563792-49563814 CCTCATATGAACACAGAGCAAGG + Intronic
949413636 3:3793823-3793845 GCCCAAAAGAACTGAAAGCAAGG - Intronic
950095380 3:10326414-10326436 CTCCGAATGAACATGGAGCATGG + Exonic
950484081 3:13262569-13262591 CCCCAAAAGAACTGAAAGCAGGG + Intergenic
950616408 3:14163258-14163280 ACCCAAAAGAACAGAAAACAGGG + Intronic
951711822 3:25591140-25591162 CATCAAATGAAGAGAGATCATGG + Intronic
953408726 3:42675505-42675527 ACCCAAAAGAACTGAAAGCAGGG - Intergenic
954924057 3:54217086-54217108 GCCCAGGTGAACAGTGAGCAAGG + Intronic
955774209 3:62416105-62416127 CCTCAAATTAGCAGAGAGCTTGG + Intronic
956141560 3:66151585-66151607 TGCCACAAGAACAGAGAGCATGG - Intronic
956620574 3:71217688-71217710 CCCTACATTAGCAGAGAGCAGGG + Intronic
958698128 3:97553265-97553287 CCCCAAAGCAACAGAGAGATTGG - Intronic
959084057 3:101832802-101832824 CCCCAAAAGTAAAGAAAGCAAGG - Intronic
959849266 3:111069579-111069601 CCTAAAGTGAAGAGAGAGCATGG - Intergenic
961682041 3:128605854-128605876 CACCAACTGACCAGATAGCATGG - Intergenic
962150819 3:132891638-132891660 ACCCAAGTGAACAAAGGGCAGGG + Intergenic
962468077 3:135678970-135678992 CACCTACTGAGCAGAGAGCAGGG - Intergenic
965329783 3:167357510-167357532 ACCCAAAAGAACTGAAAGCAGGG + Intronic
965677609 3:171214312-171214334 CCAAAAATGCAAAGAGAGCAAGG + Intronic
966091303 3:176142025-176142047 ACCCAAAAGAACTGAAAGCAGGG + Intergenic
966547845 3:181170922-181170944 GCCCAAAAGAACTGAAAGCAGGG - Intergenic
966799615 3:183750415-183750437 ACCCAAAAGAACTGAAAGCAAGG - Intronic
969559211 4:7936024-7936046 CCCCAAAAGAACAAAGTACATGG + Intronic
969690856 4:8703395-8703417 CTGCAAATGAGCAGAGAGCTGGG + Intergenic
969691005 4:8704163-8704185 CCACAAATGAACAGAGGGCCAGG - Intergenic
971029511 4:22621335-22621357 CCCTAAAGGGAGAGAGAGCAAGG + Intergenic
971094294 4:23381726-23381748 GCCCAAATGAAAAGAGATAATGG - Intergenic
972791185 4:42373020-42373042 TCACAAAGGAAGAGAGAGCAAGG - Intergenic
973373018 4:49267315-49267337 ACCCAAAAGAACTGAGAGCAGGG + Intergenic
973387983 4:49527766-49527788 ACCCAAAAGAACTGAGAGCAGGG - Intergenic
975493084 4:75010008-75010030 GCCCAAAAGAACTGACAGCAAGG + Intronic
976763489 4:88574899-88574921 ACCCAAAAGAACTGAAAGCAAGG - Intronic
978711023 4:111781175-111781197 ACCCAAAAGAACTGAAAGCAAGG + Intergenic
978856849 4:113403370-113403392 ATCAAAATGAACAGAGTGCATGG + Intergenic
979073989 4:116247125-116247147 CCCCAAATGTACAGAGTATATGG - Intergenic
982639522 4:157940648-157940670 ACCCAAAAGAACTGAAAGCAGGG + Intergenic
982756976 4:159232616-159232638 ACCAAAAAGAACTGAGAGCAGGG - Intronic
984112470 4:175635478-175635500 CCCCAATTAAAGAGAGATCATGG + Intronic
984274326 4:177591339-177591361 CCCTAGAGGAACAGAGTGCATGG - Intergenic
986422573 5:7599444-7599466 CACCAAATGCATAGAGAGAATGG + Intronic
988789975 5:34598777-34598799 TCCCGAATGAACAGGCAGCAAGG + Intergenic
989242179 5:39214394-39214416 ACCCAAAAGAACTGAAAGCAGGG + Intronic
991158314 5:63464658-63464680 ACCCAAAAGAACTGAGAGCAGGG - Intergenic
992261453 5:74974702-74974724 CCTCAAATGAGCTGAGAGGAGGG - Intergenic
992323847 5:75640892-75640914 CCCCAAAAGAATAGAAAGAATGG - Intronic
994133597 5:96260181-96260203 CCCCAGATGAATAGAGAGCCAGG + Intergenic
994670070 5:102754341-102754363 CCCCAAAGCAAGAGAAAGCAGGG - Intronic
994820411 5:104643442-104643464 CCCCACATGAAGAAACAGCACGG + Intergenic
997473126 5:134127732-134127754 CCCGCAATGACCAGAGAGGATGG - Intronic
997631594 5:135373001-135373023 CCCCTCATTAACAGAGAGGAAGG + Intronic
997691042 5:135827758-135827780 CCCCAAAGGAACAGACAGGTTGG + Intergenic
997691068 5:135827889-135827911 CCCCAAAGGAACAGACAGGTTGG + Intergenic
997862667 5:137432260-137432282 ACCCAAAAGAACTGAAAGCAGGG + Intronic
998821788 5:146063976-146063998 CCCCAAGTGAGAAGAAAGCAGGG - Intronic
999128277 5:149263110-149263132 CTCCAAATGAATAGAGTCCAGGG + Intergenic
1001134013 5:169087485-169087507 CCCCAAATGTGCAGAGGCCAGGG - Intronic
1001589180 5:172853748-172853770 CCCCAACTGAGCAAACAGCAGGG - Intronic
1001778477 5:174347207-174347229 CCCCAAATGAAAAGAGATTAGGG - Intergenic
1002372347 5:178765378-178765400 ACCCAAAAGAACTGAAAGCAAGG - Intergenic
1003263662 6:4547919-4547941 ACCCAAAAGAACTGAAAGCAGGG + Intergenic
1003485397 6:6571839-6571861 ACCCAAATGAATTGAAAGCAAGG - Intergenic
1004226866 6:13793273-13793295 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1004440661 6:15649167-15649189 ACCCAAAGGAACTGAAAGCAAGG + Intronic
1004534542 6:16487609-16487631 CCCCAGTTGAACACAGAGCCTGG - Intronic
1004684196 6:17926834-17926856 ACCCAAAAGAAGAGAAAGCAGGG + Intronic
1004735193 6:18398790-18398812 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1005272664 6:24182807-24182829 ACCCAAAAGAACTGAAAGCAAGG + Intronic
1005527513 6:26665405-26665427 CCAAAAAGAAACAGAGAGCATGG - Intergenic
1006409446 6:33863767-33863789 CCCCAAATTAACACAGTGCATGG + Intergenic
1006660116 6:35634450-35634472 ACCCAAAGGAGAAGAGAGCAGGG + Intronic
1008430397 6:51410102-51410124 CCCAAAATGAACTGAGTGCCTGG - Intergenic
1008631289 6:53365004-53365026 ACCCAAAAGAATAGAAAGCAGGG + Intergenic
1009999321 6:70932302-70932324 ACCCAAAAGAACGGAAAGCAGGG + Intronic
1010126454 6:72437889-72437911 CTCAAAAAGAACAGAGTGCAGGG + Intergenic
1013191278 6:107806192-107806214 CCCCCAATAAACAATGAGCAAGG + Intronic
1013281845 6:108645154-108645176 CACGAAATGAACAGAAAGTAAGG - Intronic
1015137515 6:129890562-129890584 CTCCAAATGCAGAGTGAGCAGGG + Intergenic
1018019627 6:159748330-159748352 CCCAAAATGAACTGAGTGCCTGG + Exonic
1019775181 7:2908339-2908361 CCCCAAGAGAATTGAGAGCAGGG - Intronic
1020786569 7:12580711-12580733 CCCCAAATCAATAATGAGCAAGG - Intronic
1022234765 7:28450650-28450672 CCACAAACAGACAGAGAGCAGGG - Intronic
1024504160 7:50147066-50147088 TCCCAAGTGAACAAAGACCATGG - Intronic
1025067201 7:55867615-55867637 GCCCAAAAGAATAGAAAGCAGGG - Intergenic
1026282125 7:68931465-68931487 GCCCAAAAGAACTGAGAGCAGGG + Intergenic
1027140710 7:75655050-75655072 GCCCAAAAGAACTGAAAGCAGGG + Intronic
1030185413 7:106757059-106757081 CACCAAATGAGGACAGAGCAGGG + Intergenic
1031078994 7:117240387-117240409 CCCCTAATGAATATAGACCAGGG + Intergenic
1032264187 7:130359361-130359383 TCCCAAATGATCACAGGGCAAGG - Intronic
1032453528 7:132054519-132054541 CCCCAAATTAACAGGGAAAATGG + Intergenic
1032541623 7:132707557-132707579 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1033601258 7:142889957-142889979 TCCCTCATGAGCAGAGAGCAAGG - Intergenic
1034400777 7:150860278-150860300 CCCCAAATGCACAGAGACACAGG - Intronic
1035000231 7:155606806-155606828 CAGCAGATGAACAGAGAGCACGG - Intergenic
1035451225 7:158978192-158978214 CTCAAAAAGAACTGAGAGCAGGG - Intergenic
1035780423 8:2223439-2223461 CCCCCAAAGAGCAGTGAGCAGGG - Intergenic
1036648558 8:10627139-10627161 CCCCAAAAGAACTGAAAGCAGGG + Intronic
1038135956 8:24785979-24786001 ACCCAAAAGAACTGAAAGCAGGG + Intergenic
1038582424 8:28760498-28760520 ACCCAAAAGAATTGAGAGCAGGG - Intergenic
1038791226 8:30670062-30670084 CCCAAAATGCACATAGAACAAGG + Intergenic
1039049127 8:33477017-33477039 CCACAATCCAACAGAGAGCATGG - Intronic
1039728306 8:40246469-40246491 CCAAAAATGAACAGAGAAAATGG - Intergenic
1041034745 8:53776528-53776550 CCCCACAGGAAGAGAGAGCTTGG + Intronic
1041206326 8:55501814-55501836 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1043131789 8:76472034-76472056 CCTCACAGGAACAGAGAACAAGG - Intergenic
1044198142 8:89402800-89402822 CCCCAAAGAAACAGAGAATAGGG + Intergenic
1045191255 8:99886518-99886540 CCCCAAAAGAATTGATAGCAAGG + Intronic
1045838176 8:106547957-106547979 ACCCAAATGAACTGAAAGCAGGG - Intronic
1047349913 8:124063987-124064009 CCCCAGATTAACACACAGCAGGG + Intronic
1047536090 8:125720813-125720835 CACATAATGGACAGAGAGCAAGG + Intergenic
1047782634 8:128122664-128122686 CCTCAACTGCAAAGAGAGCAAGG - Intergenic
1049011228 8:139888951-139888973 ACCCAAAAGAACTGAAAGCAGGG + Intronic
1050251142 9:3746136-3746158 CCGCAAATGAACATTGAGCTGGG - Intergenic
1052888570 9:33674148-33674170 CCCCAAATTAACTCAGAACATGG - Intergenic
1053655461 9:40214691-40214713 ACCCAAAATAACTGAGAGCAGGG - Intergenic
1053905835 9:42843908-42843930 ACCCAAAATAACTGAGAGCAGGG - Intergenic
1054351863 9:64024718-64024740 ACCCAAAAGAACTGAGAGCAGGG - Intergenic
1054367580 9:64360919-64360941 ACCCAAAATAACTGAGAGCAGGG - Intergenic
1054529140 9:66161610-66161632 ACCCAAAATAACTGAGAGCAGGG + Intergenic
1054675202 9:67850658-67850680 ACCCAAAATAACTGAGAGCAGGG - Intergenic
1055046854 9:71935267-71935289 CCCCAAAAGAATTGAAAGCAGGG + Intronic
1055800230 9:80027174-80027196 GCCCAAAAGAACTGAAAGCAAGG - Intergenic
1055931793 9:81566598-81566620 GCCCAAAAGGACAGAGAACAGGG + Intergenic
1056039505 9:82647973-82647995 CTCCTAATGAACAAACAGCATGG - Intergenic
1056147837 9:83751976-83751998 ACCCAAAAGAACTGAAAGCAAGG + Intronic
1056507728 9:87273241-87273263 CCCCAAAAGAATAGAAAGCAGGG + Intergenic
1056725146 9:89107704-89107726 ACCCAAATGCACAGGGATCAGGG + Intronic
1057335312 9:94150555-94150577 GCCCTAATTACCAGAGAGCAAGG - Intergenic
1057372424 9:94486289-94486311 ACCCAAAAGAACTGAGAGCAGGG - Intergenic
1057521492 9:95764054-95764076 CCCCAAATGGACTGAGTGCCAGG + Intergenic
1058267889 9:102928912-102928934 CATTAAATGAACAGAGATCAAGG + Intergenic
1059102055 9:111481603-111481625 ACCCAAAAGAACTGAAAGCAAGG + Intronic
1059243557 9:112829580-112829602 GCCCAAAAGAACTGAAAGCAAGG - Intronic
1059982122 9:119784606-119784628 CCTAAAATGAACAGAGAGCTGGG + Intergenic
1060113051 9:120920148-120920170 CCCCAAATGCACAGAGACTGGGG + Intronic
1061246594 9:129403918-129403940 CTGGAAATGCACAGAGAGCAGGG - Intergenic
1061527754 9:131181343-131181365 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1062353125 9:136148768-136148790 GCCCAGATGAGCAGAGACCAGGG + Intergenic
1062717036 9:138016263-138016285 CCACAAAGGCACAGAGAGCTTGG + Intronic
1203696726 Un_GL000214v1:105320-105342 ACCCAAAAGAACTGAGAGCAGGG + Intergenic
1203552486 Un_KI270743v1:175709-175731 ACCCAAAAGAACTGAGAGCAGGG - Intergenic
1186173851 X:6904731-6904753 CCCCAGTTGGACAGTGAGCAGGG - Intergenic
1186580300 X:10810511-10810533 ACCCAAAAGAATAGAAAGCAGGG - Intronic
1187241957 X:17522041-17522063 CCCCAGGGGAGCAGAGAGCAAGG - Intronic
1188783973 X:34321365-34321387 TCCCAAATCAAAAGAGAGCCTGG + Intergenic
1189914672 X:45844977-45844999 GCCCAAAAGAACTGAAAGCAAGG + Intergenic
1192348848 X:70337753-70337775 ACCCAAATGAATTGAAAGCAGGG - Intronic
1193615070 X:83677019-83677041 CACCAGCTGTACAGAGAGCATGG - Intergenic
1193896720 X:87123190-87123212 ACCCAAATGGAAGGAGAGCAGGG + Intergenic
1193921219 X:87429028-87429050 CCCTCAATAAACAGAGAGAATGG - Intergenic
1194563761 X:95455720-95455742 CTTCAAATGAACACTGAGCAAGG + Intergenic
1194634968 X:96334552-96334574 AAACAAATGAACCGAGAGCAAGG - Intergenic
1194858179 X:98960246-98960268 CACCAAGTCAGCAGAGAGCAGGG + Intergenic
1195021451 X:100832805-100832827 CCCCACATGAACTGAGGGGAGGG + Exonic
1195571397 X:106401903-106401925 CCCCAGAAGGACAGAGGGCATGG + Intergenic
1197449407 X:126593535-126593557 CACCAAATGAACACACACCAGGG - Intergenic
1199108494 X:143901553-143901575 GCCCAAATGAATTGAAAGCAGGG + Intergenic
1199850364 X:151721634-151721656 CCCCAAATGGGCAGGGAGCCAGG - Intronic
1199854838 X:151751817-151751839 CCCCAGTTGAACAGGGAGCTGGG + Intergenic
1200224019 X:154406893-154406915 ACCCAAAAGAACTGAAAGCAGGG - Intronic
1200312890 X:155097769-155097791 ACCCAAATGAATTGAAAGCAGGG + Intronic
1201153755 Y:11111286-11111308 ACCCAAAGGAACTGAGAGCAGGG - Intergenic