ID: 1088470596

View in Genome Browser
Species Human (GRCh38)
Location 11:110184599-110184621
Sequence TGGAGATGGGAAAGTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088470588_1088470596 12 Left 1088470588 11:110184564-110184586 CCTTCTGATGGGGGTGGGAGGCC 0: 1
1: 0
2: 1
3: 23
4: 228
Right 1088470596 11:110184599-110184621 TGGAGATGGGAAAGTCCTAGAGG 0: 1
1: 0
2: 0
3: 23
4: 235
1088470587_1088470596 13 Left 1088470587 11:110184563-110184585 CCCTTCTGATGGGGGTGGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 318
Right 1088470596 11:110184599-110184621 TGGAGATGGGAAAGTCCTAGAGG 0: 1
1: 0
2: 0
3: 23
4: 235
1088470585_1088470596 14 Left 1088470585 11:110184562-110184584 CCCCTTCTGATGGGGGTGGGAGG 0: 1
1: 1
2: 5
3: 53
4: 437
Right 1088470596 11:110184599-110184621 TGGAGATGGGAAAGTCCTAGAGG 0: 1
1: 0
2: 0
3: 23
4: 235
1088470591_1088470596 -9 Left 1088470591 11:110184585-110184607 CCTGAAGGAAGCCCTGGAGATGG 0: 1
1: 0
2: 3
3: 207
4: 7643
Right 1088470596 11:110184599-110184621 TGGAGATGGGAAAGTCCTAGAGG 0: 1
1: 0
2: 0
3: 23
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088470596 Original CRISPR TGGAGATGGGAAAGTCCTAG AGG Intronic
900462302 1:2807540-2807562 TTGGGATGGGAAAGTCCGGGTGG - Intergenic
902362168 1:15947898-15947920 AGGTGATGGGGAAGGCCTAGGGG - Intronic
902640487 1:17763443-17763465 TTGAGATGGGAAAGCCATGGAGG - Intronic
902709639 1:18229988-18230010 TGGAGATGGGAAAATAGCAGTGG + Intronic
904087404 1:27918939-27918961 GGAAGATGGAAAAGTCCCAGAGG + Intergenic
904148416 1:28414816-28414838 TGGAGTAGGGAAAGTGATAGAGG + Intronic
906000877 1:42423716-42423738 TGAAGCTGGGAGAGTCCTAGAGG - Intergenic
908713693 1:67047151-67047173 TGGGGATGAGAAAGACATAGTGG - Intronic
911818328 1:102383487-102383509 TAGAGGTGGGAAAGTCTGAGAGG - Intergenic
913967154 1:143385791-143385813 TGGAGATGGGAAATGCCACGAGG + Intergenic
914061531 1:144211398-144211420 TGGAGATGGGAAATGCCACGAGG + Intergenic
914117619 1:144754971-144754993 TGGAGATGGGAAATGCCACGAGG - Intergenic
915733047 1:158067542-158067564 TAGAGATGGGAAGGCCCTTGGGG + Intronic
916289691 1:163151293-163151315 TGTAAATGGAAAAGTCCAAGTGG + Intronic
916459360 1:165007332-165007354 TAGAGATGGAAATGTCCTGGTGG - Intergenic
919516651 1:198533428-198533450 TGGAAATGGTAAAGTAGTAGTGG + Intronic
920702557 1:208228850-208228872 TGGAGATGGAGAGGCCCTAGAGG - Intronic
921838952 1:219808002-219808024 TGGAGATGGGAATGACAAAGAGG - Intronic
922353155 1:224751634-224751656 TGGAGATGGCAGAGTCTTTGTGG + Intergenic
1065693603 10:28359163-28359185 TGGAGAGGGGAAAGGTCTGGAGG - Intergenic
1067187669 10:44044169-44044191 AGGAGATGGGAATGGCCAAGGGG + Intergenic
1074199819 10:111224746-111224768 TGTAGATGGTAAAGTCCCAGGGG - Intergenic
1074680206 10:115898429-115898451 TGGAGATGGGACAGCCCACGTGG - Intronic
1075679622 10:124322977-124322999 TGGAGGTGGGAGAGTTCTCGTGG - Intergenic
1075738696 10:124680079-124680101 TGGAGAAGGGAAATTCCTCTTGG + Intronic
1078342157 11:10505407-10505429 TGGGGATGGGAAAGGCAAAGGGG - Intronic
1079648967 11:22902388-22902410 TGTAGAGGGGAAAGTCTAAGAGG - Intergenic
1083421312 11:62554755-62554777 TGGAGAAGGGAGGGGCCTAGGGG + Intronic
1084656788 11:70524262-70524284 CGGAGATGGGAAAGCACCAGGGG + Intronic
1084950783 11:72664252-72664274 TGGAGATGGGGAAGGCTTAAGGG - Intronic
1086571943 11:88295245-88295267 GTGAGCTGGGAAATTCCTAGTGG + Intronic
1087273340 11:96135277-96135299 TGGAGACTGGGAAGTCCAAGGGG - Intronic
1087329086 11:96756675-96756697 TGGAGATGGGAGAGGCCAAGTGG + Intergenic
1088456909 11:110042306-110042328 AGGAGATGGGAAAGGCAAAGAGG + Intergenic
1088470596 11:110184599-110184621 TGGAGATGGGAAAGTCCTAGAGG + Intronic
1089150888 11:116363320-116363342 CATAGATGGGGAAGTCCTAGGGG - Intergenic
1090419849 11:126567187-126567209 TGGAGATAGGAAATTTGTAGAGG + Intronic
1090649607 11:128794679-128794701 TGGAGAAAAGAAAGTCCTTGAGG + Intronic
1092113778 12:5984079-5984101 CTGAGATGTGAAAGCCCTAGTGG - Intronic
1093224769 12:16468958-16468980 AGTAGATGAGAAACTCCTAGGGG + Intronic
1093485594 12:19648776-19648798 TCTAGGTTGGAAAGTCCTAGAGG - Intronic
1094048095 12:26189482-26189504 TTGAGATGGGAAAGTTTTAGAGG - Intronic
1096800397 12:54106812-54106834 TGGAGATGGGCAAGGCTGAGGGG - Intergenic
1099452694 12:82826775-82826797 TGAAGATTGGAATGTCCTATTGG + Intronic
1099816022 12:87648605-87648627 TGGAGAAAGAAAAGCCCTAGAGG - Intergenic
1100628451 12:96361353-96361375 TGGAGATAGGAAAGTAAAAGAGG - Intronic
1101419802 12:104541234-104541256 TGGAGATGCAAAAATCCTTGAGG + Intronic
1101750318 12:107578079-107578101 TGGAGATGGGAAAGAATTCGAGG - Intronic
1103122353 12:118391278-118391300 TGGAGGTAGGAAAGCCCTATGGG + Exonic
1103722564 12:122982478-122982500 GGGAGATGGCGAGGTCCTAGAGG + Exonic
1104165199 12:126221678-126221700 TCTAGCTGTGAAAGTCCTAGAGG - Intergenic
1104382400 12:128318967-128318989 TGGAGATGCGTAAGCTCTAGGGG - Intronic
1107373700 13:39779572-39779594 TGGAGATGAGAAAGACCAAATGG + Intronic
1108891006 13:55259200-55259222 TGAAGACGTGGAAGTCCTAGAGG - Intergenic
1109308060 13:60662184-60662206 TGGATATGAGAAAGTGCTGGGGG - Intergenic
1109375215 13:61484444-61484466 TGGAGATGGCTGAGACCTAGAGG - Intergenic
1111432737 13:88164188-88164210 AGGACATTGGAAAGGCCTAGAGG - Intergenic
1112504303 13:99966393-99966415 TGGAGATGGGAAAGGGAAAGAGG + Intronic
1112927796 13:104697863-104697885 TCGGGATGGTAAAGTCCAAGGGG - Intergenic
1114565005 14:23624149-23624171 TGGAGATGGGACTGTCCTGAAGG + Intergenic
1116968345 14:51038532-51038554 TGGAGAGAGGAAAGCCTTAGAGG + Intronic
1118808080 14:69255010-69255032 TGGAGACGGGAAGGTCAGAGAGG + Intergenic
1119406167 14:74401080-74401102 TGGAACTGGGAAAGGCCTCGAGG + Intergenic
1119937441 14:78605104-78605126 TGGAGATGAGGAAGTAGTAGGGG - Intronic
1120720246 14:87882666-87882688 TGGAGATGGGAAAGAGCTTGAGG - Intronic
1122375387 14:101253567-101253589 TGGACATGGGAAATTCCTCAGGG + Intergenic
1122884050 14:104702737-104702759 TGGAGCTGTGAAAGTTCTGGGGG - Intronic
1125099524 15:35895027-35895049 TGTAGCTATGAAAGTCCTAGAGG + Intergenic
1125204026 15:37130660-37130682 TGAAGATGAGTAAGTCCTACAGG - Intergenic
1126879644 15:53080861-53080883 TAGAGCTGGAAAAGACCTAGAGG + Intergenic
1127336897 15:57995764-57995786 TAGAAATGAGAATGTCCTAGGGG + Intronic
1127598003 15:60506397-60506419 TGAAGATATGAAAGACCTAGAGG + Intronic
1128046303 15:64620629-64620651 TGGAGTTGGGGAAGTACAAGGGG + Intronic
1128603027 15:69013870-69013892 TGCAGATTGGGATGTCCTAGTGG - Intronic
1129829552 15:78659630-78659652 AGGAGATGGCAAAGTCACAGAGG + Intronic
1130101328 15:80896346-80896368 GGGAGATTGCAAACTCCTAGTGG + Exonic
1130199889 15:81815260-81815282 TGGAACTGGGAAAGGTCTAGAGG - Intergenic
1130862540 15:87903854-87903876 TGACTTTGGGAAAGTCCTAGTGG + Intronic
1131490048 15:92854831-92854853 TGGAGATGAGAAAGTCCTGTTGG - Intergenic
1132300181 15:100770276-100770298 AGGAGAGAGGAGAGTCCTAGTGG + Intergenic
1132464376 16:71053-71075 TGTAGCTGGGAAGATCCTAGGGG + Intronic
1133405605 16:5521912-5521934 TGGAGATGGGGATGCCCTGGAGG + Intergenic
1134453570 16:14378350-14378372 TGGACATGGGAAAGTCTAACGGG + Intergenic
1135852580 16:25977915-25977937 TGGAGATGGGCAAGTTGTAATGG + Intronic
1136125151 16:28174024-28174046 TGGAGACAGGAAAGACCAAGAGG - Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1138985374 16:62321821-62321843 TGGAAATAGGAAATTCATAGGGG - Intergenic
1142308276 16:89297996-89298018 TGGAGATGGGGAAGGCATGGAGG - Intronic
1142732297 17:1868152-1868174 TGGAGAAAGGAAAGGCCCAGTGG - Intronic
1143451444 17:7039058-7039080 TGGGGCTGGGAAAGTCTGAGTGG + Intronic
1146288991 17:31594728-31594750 TGGAGATGGGAAAGAACATGGGG + Intergenic
1146291480 17:31610643-31610665 TGGAGATGAGGCAGTCCCAGGGG + Intergenic
1147538087 17:41333929-41333951 TGTAGTTGGGACAGTACTAGAGG - Intergenic
1148339288 17:46863802-46863824 TGGATTTAGGACAGTCCTAGTGG + Intronic
1148435271 17:47679340-47679362 TGGGGATGGGAAAGGGGTAGGGG - Intronic
1148989331 17:51651834-51651856 TTGTGCTGGGAAAGTCATAGGGG + Intronic
1151036249 17:70804143-70804165 TGGGAATGGGAAAGTGCTACCGG - Intergenic
1151257146 17:72886704-72886726 TTGAGATCTGAAAGTGCTAGTGG + Intronic
1151342353 17:73480066-73480088 TGGATACGTTAAAGTCCTAGAGG - Intronic
1151378129 17:73705582-73705604 TCGTGATGGGAAAGTCATTGAGG - Intergenic
1151598783 17:75093854-75093876 GGCCGATGAGAAAGTCCTAGGGG + Intronic
1153319589 18:3759655-3759677 TGGAGATGTGAAATTCCCAGGGG - Intronic
1154245277 18:12691646-12691668 TGGAGATGGGATTGTACTAGGGG - Intronic
1155755083 18:29483064-29483086 TGGACATGGGAAAGTCTTCATGG + Intergenic
1156357189 18:36351877-36351899 AGGAGGTGGGAATGTACTAGTGG - Intronic
1156768933 18:40696033-40696055 TGTAGCTGTGAAAGTCTTAGAGG - Intergenic
1156904938 18:42341210-42341232 TGGAGATGAGAGAGACCTTGAGG + Intergenic
1157326094 18:46669670-46669692 TGGAGATGGGAAGGTGGAAGGGG + Intronic
1158999889 18:62963971-62963993 TTAAGATGGGCAAGTCCTGGTGG - Intronic
1159035873 18:63276494-63276516 GGGAGACTGGAAAGTCCTGGGGG - Intronic
1159848642 18:73498290-73498312 TGGGAATGTGAAATTCCTAGTGG + Intergenic
1160122058 18:76139586-76139608 TGGAAATGGGAAATTTCTACAGG + Intergenic
1162123855 19:8488718-8488740 TGGAGAATGGGAAGTCCAAGGGG + Exonic
1163193414 19:15696650-15696672 TGGGGATGAGTAGGTCCTAGAGG + Intronic
1163220342 19:15914146-15914168 TGGGTTTGGGAAGGTCCTAGAGG - Intronic
1166643355 19:44512984-44513006 TGGAGATGGGCAAGGACTAGAGG - Intronic
1167000900 19:46745609-46745631 TGGAGGTGGGAGCGTCCAAGGGG - Intronic
1167011308 19:46810048-46810070 TGGAGAACGGGAAGTCCAAGGGG + Intergenic
1202700938 1_KI270712v1_random:163286-163308 TGGAGATGGGAAATGCCACGAGG + Intergenic
925153766 2:1634994-1635016 TGGAGATGGGACAGGGCCAGTGG + Intronic
925317666 2:2938228-2938250 TGGAGATGGGAAAGTGAGTGAGG - Intergenic
926558213 2:14385326-14385348 TGGAGAAGGGAACTTCCCAGAGG + Intergenic
927249268 2:20983231-20983253 AGGAGGGGGGAGAGTCCTAGGGG + Intergenic
927863630 2:26575566-26575588 TGGGGATGGCCAAGTCCAAGGGG - Intronic
932038559 2:68274020-68274042 TGGAGAAGGAAAAATCCTAAGGG + Intergenic
933384393 2:81591319-81591341 TGGAGCTGGTAAAGTCCCTGTGG + Intergenic
934171866 2:89546775-89546797 TGGAGATGGGAAATGCCACGAGG + Intergenic
934282174 2:91621093-91621115 TGGAGATGGGAAATGCCACGAGG + Intergenic
934723809 2:96602046-96602068 ATGAGATGGGAAGGTCCTGGGGG + Intronic
934727847 2:96636643-96636665 TGGAAAGGGGAAAATCGTAGAGG - Intronic
935178010 2:100666060-100666082 TGGAGATGGAAAATTCCTATAGG + Intergenic
937643656 2:124242028-124242050 TGGAGAATGGAAAGTACCAGGGG + Intronic
939166431 2:138645927-138645949 TGGAGATGGGGAGCTCATAGTGG + Intergenic
939873120 2:147547311-147547333 TGGAGGTTGGGAAGTCCAAGAGG + Intergenic
940176566 2:150884029-150884051 TGGAGATGGAAATGTTCTTGAGG + Intergenic
940366680 2:152856081-152856103 TTTATATGGGAAAGACCTAGAGG - Intergenic
941567431 2:167126695-167126717 TGGAGATGGGAAAAACCATGGGG + Intronic
942398172 2:175574199-175574221 CGGAGATGGGGAAGTCAGAGTGG - Intergenic
942893495 2:181020597-181020619 AGCAGATGGAAAAGTCGTAGTGG - Intronic
943657963 2:190529303-190529325 TGGAGGAGGGAAGGTCATAGAGG - Intronic
944148386 2:196530946-196530968 AGGAGGTGGGAGAGTTCTAGAGG - Intronic
944287670 2:197970149-197970171 TGGAGGCTGGAAAGTCCAAGAGG + Intronic
944921841 2:204422365-204422387 TGGAGGCTGGGAAGTCCTAGAGG + Intergenic
945401830 2:209391798-209391820 TGGAGATGGAAAAGTCCGAATGG - Intergenic
947510970 2:230754101-230754123 TGGAGATAGGTAAAACCTAGAGG + Intronic
1171796056 20:29567530-29567552 TGGAGATGGGCAAGGCTGAGGGG + Intergenic
1171852178 20:30316637-30316659 TGGAGATGGGCAAGGCTGAGGGG - Intergenic
1174312464 20:49668630-49668652 TGCTGATGGGAATGTGCTAGAGG + Intronic
1175277085 20:57779549-57779571 TGGAGACTGGAAAGTCCATGGGG + Intergenic
1178561684 21:33643659-33643681 TGATGATGGCAAAGTTCTAGAGG - Intronic
1180105863 21:45617639-45617661 TGGAGATGGGAAAGTGGAGGAGG + Intergenic
1180668872 22:17537168-17537190 TCCAGATGGGAAAGTTCTGGAGG - Exonic
1182068995 22:27450223-27450245 TGGAGATGGGAAAATTCCAAGGG - Intergenic
1182989274 22:34751584-34751606 TGGAGATGGGGAAGACTGAGTGG - Intergenic
1184099894 22:42336492-42336514 TGGAGCTGGGAGAGTCCACGTGG - Intronic
949349784 3:3113604-3113626 TGGACATGGACAACTCCTAGTGG + Intronic
950266326 3:11575811-11575833 TGGATATGGGAAAGTTGCAGGGG - Intronic
954464829 3:50648245-50648267 TAGAGATGGGCAGGGCCTAGGGG + Exonic
955461243 3:59185749-59185771 TGGAGCTGGGAAAGTCCTTTTGG - Intergenic
955474932 3:59326818-59326840 TGGAGGTGGGAAACCACTAGGGG - Intergenic
955933897 3:64083829-64083851 GGGAGATGGGAATGTCCAAGGGG + Intergenic
967191370 3:186987656-186987678 CGGAGATGGGAGAAACCTAGGGG + Intronic
967306239 3:188062378-188062400 ATGAGATGGGAAAGCCATAGAGG + Intergenic
967973430 3:195016010-195016032 GGGAGATGGGAAGGTCCTGCTGG + Intergenic
969027883 4:4189112-4189134 TGGAGATGGGAAATGCCATGAGG - Intronic
969136389 4:5032733-5032755 GGAAGATGAGAAAGTTCTAGAGG - Intergenic
969835299 4:9835410-9835432 TGGAGATGGGGAGGTTCAAGTGG - Intronic
973158925 4:46992639-46992661 GGGAGATGGGAAAGTACGGGTGG + Intronic
976117008 4:81738644-81738666 AGGAGATGGGTGAGTCCTGGAGG - Intronic
976379061 4:84378896-84378918 TGAGGCTGGGAAAATCCTAGGGG + Intergenic
980717432 4:136645202-136645224 TTGAGATTGGAAGCTCCTAGAGG - Intergenic
981485545 4:145282298-145282320 TGGAGATGGGAAAAACTGAGAGG + Intergenic
982130920 4:152227963-152227985 TGGAAGCGGGAAAGTCCTGGTGG - Intergenic
982841605 4:160194832-160194854 TGGAGGTCGGCAAGTCCTAAAGG + Intergenic
984394505 4:179177784-179177806 TGCAAATGGGAAACTACTAGAGG - Intergenic
984765691 4:183398815-183398837 CGGAGATCGCAAGGTCCTAGCGG + Intergenic
987326812 5:16819993-16820015 AGGAGAGGAGACAGTCCTAGTGG + Intronic
988617784 5:32792413-32792435 CGGAGATGGAAAAGTCACAGTGG - Intergenic
989179197 5:38558961-38558983 TGGCAGAGGGAAAGTCCTAGTGG + Intronic
991008170 5:61852824-61852846 TGGAGATGAAAAAGTACCAGTGG + Intergenic
991290042 5:65024772-65024794 TGGAGATGGGAAAATTACAGAGG - Intergenic
991400251 5:66244343-66244365 TGGAGGTGGGAAAGTCAGATGGG - Intergenic
992380281 5:76229519-76229541 TGAAGGTGGGAAAGTCTTAAAGG - Intronic
994612670 5:102064763-102064785 TGGAGATGGGATAATGGTAGTGG - Intergenic
994905212 5:105832277-105832299 TGGAAATGGGAAAGTCAGTGAGG - Intergenic
997397520 5:133576223-133576245 TGGACATGGGATGGACCTAGGGG - Intronic
997473836 5:134131498-134131520 TGGAGCTGGGAGAGGCCTTGGGG - Intronic
997969128 5:138385940-138385962 TAGAGATGGGAAAGAGCTAATGG + Intronic
999507599 5:152214369-152214391 TGGAGAGGGAAAAGTGCTGGTGG - Intergenic
1002327514 5:178419529-178419551 TGTAGATGAGAAAGTGCTGGGGG + Intronic
1003598156 6:7493370-7493392 AGGAGATGGTAAACTCCTTGAGG - Intergenic
1004115244 6:12760441-12760463 TGGAAATGAGAAAGACCTACTGG + Intronic
1004970782 6:20907782-20907804 TGGGAATGGGAAGGTCCTGGAGG + Intronic
1005184462 6:23149579-23149601 TGGAGATGAGAAACTCGTTGGGG - Intergenic
1006812721 6:36830452-36830474 GGGAGATGGGTAAGTGCCAGGGG - Intronic
1006924598 6:37647541-37647563 GGGAGATTGGAAATTCCAAGAGG + Intronic
1007546549 6:42698779-42698801 AGCAGATGGTAAAGACCTAGAGG - Intronic
1007738052 6:43994177-43994199 GGGAGGAGGGAAAGTCCTGGGGG + Intergenic
1007752711 6:44080135-44080157 TGAAGATGGGGAACTCCTAGAGG - Intergenic
1011496623 6:87943188-87943210 TTTAGATGGGAAAGTCCTTAAGG - Intergenic
1013339364 6:109198361-109198383 TGGAGATGGGCAAATACTGGAGG - Intergenic
1016220181 6:141659048-141659070 TGGAGGCTGGAAAGTCCTAGAGG + Intergenic
1016308072 6:142703945-142703967 TGGAGGTGGGAAACTCATATAGG + Intergenic
1016402508 6:143695702-143695724 TGTAGATGACAAAGTCCCAGAGG - Intronic
1017571105 6:155745370-155745392 TGAAGATTGGAAAGACCTACCGG - Intergenic
1018035184 6:159875597-159875619 TGAAGAGGAGAAAGTCCCAGGGG - Intergenic
1019046024 6:169146865-169146887 TGGAGAGGGGAAAGGACAAGGGG - Intergenic
1019803273 7:3104384-3104406 TGGAGATGGGGAAGACACAGGGG - Intergenic
1020468125 7:8504144-8504166 TGGAAATGGGAAAGGCTTTGTGG - Intronic
1021513277 7:21456850-21456872 TGGGGATGGGAAAGACCTTGGGG - Intronic
1021516267 7:21490607-21490629 TGGAGGTTGGAAAGGCATAGGGG + Intronic
1022258309 7:28680879-28680901 TGGACATGATAAAGTCCTGGTGG + Intronic
1023013536 7:35943712-35943734 TGGAGATGCGAAAATCACAGGGG + Intergenic
1023776498 7:43612790-43612812 TAGAGCTGGGAAAGTTCTTGGGG + Intronic
1024063684 7:45716408-45716430 TGAGGATGAGAAAATCCTAGTGG - Exonic
1024077592 7:45830122-45830144 TGGAGATGCGAAAATCACAGGGG - Intergenic
1025126821 7:56351290-56351312 TGGAGATGCGAAAATCACAGGGG + Intergenic
1026401223 7:70015193-70015215 TGGAGAAGGCAAAGTCTTATTGG + Intronic
1026770978 7:73198821-73198843 TCTAGTTGGGAAAGTCCAAGAGG - Intergenic
1027011845 7:74752218-74752240 TCTAGTTGGGAAAGTCCAAGAGG - Intronic
1027076195 7:75193833-75193855 TCTAGTTGGGAAAGTCCAAGAGG + Intergenic
1030508057 7:110449527-110449549 TAGAACTGGGAAAATCCTAGAGG - Intergenic
1031476002 7:122222553-122222575 TGGAGAAGGACAAGTCCTTGTGG - Intergenic
1032017818 7:128391124-128391146 TTGAGATGGGAAAGATCTAAGGG - Intergenic
1032267445 7:130379469-130379491 TGGTGCTGGGAAAGCCCTGGGGG + Intergenic
1032668039 7:134056873-134056895 CGGTGATGGGAATGTCCTGGAGG + Intronic
1033016407 7:137675841-137675863 TAGAAATGGAAAAGTCATAGAGG - Intronic
1033138053 7:138801072-138801094 TGGAGATGGGACATTCGAAGAGG - Intronic
1033240235 7:139673042-139673064 TGGAGGACAGAAAGTCCTAGTGG + Intronic
1035311752 7:157974246-157974268 TGGAGATGAGAAAATGCTAGTGG - Intronic
1036234801 8:7029353-7029375 AGGAGATGGCAAAGTCCTGGTGG + Intergenic
1037176148 8:15948612-15948634 TCGAGATGGTAAAGCCCTATTGG + Intergenic
1038692426 8:29775331-29775353 TCAAGATGGGAAAGTCAAAGGGG + Intergenic
1045077131 8:98582461-98582483 TGGAAATAGGAAAGAACTAGGGG - Intronic
1045295789 8:100870699-100870721 TGGAGATGGCAGTGTCCTAGGGG + Intergenic
1048497565 8:134947804-134947826 TGAAGATGGGGAAAACCTAGTGG - Intergenic
1052159327 9:25235584-25235606 CGGAGGTGTGAAAGTGCTAGAGG - Intergenic
1053789960 9:41679895-41679917 TGGAGATGGGCAAGGCTGAGGGG - Intergenic
1054155177 9:61634862-61634884 TGGAGATGGGCAAGGCTGAGGGG + Intergenic
1054178299 9:61891584-61891606 TGGAGATGGGCAAGGCTGAGGGG - Intergenic
1054474969 9:65565970-65565992 TGGAGATGGGCAAGGCTGAGGGG + Intergenic
1054659230 9:67689240-67689262 TGGAGATGGGCAAGGCTGAGGGG + Intergenic
1056838334 9:89976363-89976385 GGGTGAAGGGAAGGTCCTAGAGG - Intergenic
1060379386 9:123152684-123152706 TGGAGATGGGTAAATCTTAGTGG + Intronic
1061449854 9:130662029-130662051 TGGAGAGGGCAAAATCCTCGGGG + Intergenic
1061952740 9:133945448-133945470 TGTGGATGTGAAAGTGCTAGTGG - Intronic
1186515129 X:10161206-10161228 GGGAGATAGGAAAGCCCTGGTGG + Intronic
1186845898 X:13530868-13530890 TGGAGTTGGGGAAGTGGTAGTGG - Intergenic
1192125125 X:68494721-68494743 TGGAGAAGGGAAAGAGGTAGAGG + Intergenic
1194498375 X:94647663-94647685 TGGAAATGGGTAAGTGGTAGAGG - Intergenic
1195619402 X:106938019-106938041 TGGAGATGGGAGCATTCTAGCGG + Intronic
1197303623 X:124812821-124812843 TGTAGTTGAGAAAGTTCTAGTGG - Intronic
1197663014 X:129194089-129194111 TAGAAATGGGAAAGGCCCAGAGG - Intergenic
1197868303 X:131041785-131041807 AGGAGATGGGAAAGTAGCAGAGG - Intergenic
1199328007 X:146524106-146524128 TGGAGATGGGAAAACGCTAGTGG + Intergenic
1199788441 X:151127154-151127176 TGGAGATTAGAAAGGCTTAGAGG + Intergenic
1199874624 X:151920557-151920579 TGCAGATGGGAAAGGGGTAGGGG - Intronic
1201856371 Y:18548861-18548883 TGGAGGTGGGGAAGTCCAAGGGG + Intronic
1201876950 Y:18771523-18771545 TGGAGGTGGGGAAGTCCAAGGGG - Intronic