ID: 1088472520

View in Genome Browser
Species Human (GRCh38)
Location 11:110201608-110201630
Sequence CTGGATATTCACAACACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088472520 Original CRISPR CTGGATATTCACAACACAGG AGG Intronic
901173646 1:7282765-7282787 CTGTATTTACACAACACTGGGGG + Intronic
906283565 1:44570431-44570453 CTGAATGTCCACCACACAGGAGG + Intronic
906466799 1:46088824-46088846 GTGGAATTTCACAACACTGGGGG + Intronic
907501391 1:54884105-54884127 CTGGGTATTCCCAACACACTAGG + Intronic
908340388 1:63172469-63172491 CTGGATGATCAAAACAGAGGGGG - Intergenic
910878312 1:91898844-91898866 CTACATATACACAACACAGATGG - Intronic
912871992 1:113315992-113316014 CTGGATATCCATTACACAGAAGG + Intergenic
913712370 1:121498074-121498096 TTGGAGAGTCATAACACAGGAGG - Intergenic
916513336 1:165493019-165493041 CTGGAGTTTAAAAACACAGGAGG + Intergenic
920396429 1:205649360-205649382 CAGGAGAATCACAACCCAGGAGG - Intergenic
923282450 1:232457117-232457139 ATGGGAATTCAAAACACAGGTGG + Intronic
923830970 1:237556764-237556786 CTGAAGAGTCATAACACAGGGGG + Intronic
924359627 1:243224119-243224141 CTTGATATTCACAACCCATTTGG + Intronic
1063763806 10:9113617-9113639 CTGAATATTCACAACTCAAATGG + Intergenic
1063953863 10:11247916-11247938 CTGGGTCTTCAGAACAGAGGAGG - Intronic
1064504561 10:16014740-16014762 TTGCATACTCACAACACAGGTGG - Intergenic
1064835725 10:19528025-19528047 TTGGAAAATCACAACATAGGTGG - Intronic
1074234053 10:111566983-111567005 CTGGGTATTCAAAACAGAAGCGG + Intergenic
1074523150 10:114242889-114242911 CTGGATCTTTACAACACTGGGGG + Intronic
1075648712 10:124113378-124113400 CTGGATTTTCACAAATGAGGTGG - Intergenic
1076009518 10:126976410-126976432 CTGGATATGCAGAAAACAGCTGG + Intronic
1081140874 11:39498080-39498102 CTAATTATTCACAACTCAGGAGG - Intergenic
1082079274 11:47999660-47999682 CTACATATTAACAACACATGAGG - Intronic
1082233987 11:49800364-49800386 CTGTATTGTCACAAAACAGGAGG - Intergenic
1085064943 11:73486152-73486174 CTGAATACTCACAACACTGGAGG + Intronic
1085947897 11:81294341-81294363 CTGGATAATCACAAAGCAAGAGG + Intergenic
1086597102 11:88585716-88585738 CTGAATATTGACAACAGAGAAGG - Intronic
1087876285 11:103361919-103361941 CTGGATATTCAGAATAAAAGTGG + Intronic
1088472520 11:110201608-110201630 CTGGATATTCACAACACAGGAGG + Intronic
1093956581 12:25227345-25227367 TTGGATATTCTCGACACAGCAGG - Exonic
1096432056 12:51553735-51553757 CTGCTTATTCACAATACATGTGG - Intergenic
1096782929 12:54001189-54001211 CTAGAGATTCACAAAACAGAAGG + Intronic
1105750713 13:23420111-23420133 GTGGATACCCACACCACAGGTGG - Intronic
1108712974 13:53052429-53052451 CTGGATCTTCCCCAGACAGGAGG + Intergenic
1111591436 13:90352688-90352710 CTGAATATTGAAAAGACAGGTGG + Intergenic
1112855192 13:103760033-103760055 ATAGACATTCAGAACACAGGTGG - Intergenic
1112933916 13:104775811-104775833 TTGGATTTTCACAAGGCAGGGGG + Intergenic
1113122567 13:106940025-106940047 CTGCATATACACAGCACAGGAGG + Intergenic
1113548656 13:111174986-111175008 CTGTATGCTCCCAACACAGGAGG - Intronic
1114436648 14:22712454-22712476 CTGGATATTAACATCACAGGAGG - Intergenic
1114713747 14:24803989-24804011 CTGGATGTGGACACCACAGGTGG - Intergenic
1115516637 14:34192029-34192051 CTGGATAATCACTCCCCAGGGGG + Intronic
1117152353 14:52902437-52902459 TTAGATATTAACAACAGAGGGGG + Intronic
1131757879 15:95585768-95585790 CTGGATACTCACAAAACATAAGG - Intergenic
1132495726 16:262405-262427 CTTGCTATTCAAAACACAGAAGG - Exonic
1135887552 16:26324924-26324946 TTGGATAATGACAACAAAGGTGG - Intergenic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1142369597 16:89670947-89670969 CAGGGCATTCTCAACACAGGGGG - Intronic
1144246690 17:13373289-13373311 CTGCAAAATCAAAACACAGGGGG - Intergenic
1144870763 17:18369245-18369267 CTGGACTTACACTACACAGGTGG + Intergenic
1150858856 17:68779819-68779841 CTGGATCTACACACAACAGGAGG - Intergenic
1153195690 18:2593624-2593646 CTGGTTATTCAAAACATAGTTGG - Intronic
1153523344 18:5972472-5972494 CTGAGTATTCACAACACACTGGG - Intronic
1153528961 18:6024305-6024327 GTTGATAATCACAACACAGGTGG + Intronic
1156176452 18:34552603-34552625 CTGCATATTCTCACCATAGGTGG - Intronic
1156530867 18:37813862-37813884 CTGGAGAATCCTAACACAGGAGG + Intergenic
1156540729 18:37907270-37907292 CTGTATATTCTCAACCCAGATGG + Intergenic
1157699906 18:49755689-49755711 ATGGACATTCTCAAAACAGGGGG - Intergenic
1160092180 18:75837896-75837918 GTGAAGATTCACAACACAGGAGG + Intergenic
1163770554 19:19188597-19188619 CTGGAAGTTCACATCCCAGGAGG + Intronic
930393145 2:50786733-50786755 CTGGATGTTAAAAGCACAGGTGG - Intronic
932264478 2:70355398-70355420 CTGGATATTCTCATGAAAGGAGG + Intergenic
934677471 2:96259843-96259865 CTGGTTAATAACAGCACAGGTGG - Intronic
935213734 2:100959472-100959494 CTGGCTATTCAGAACACATTGGG + Intronic
935837780 2:107074274-107074296 TTGGAGATTCACAACACATATGG + Intergenic
937393420 2:121513549-121513571 CTGGAGATCCCCAACACAGTGGG - Intronic
938710285 2:133970728-133970750 CTGGGTATCCACAACTCTGGTGG + Intergenic
946507463 2:220317219-220317241 CTGGATGTGCACCACCCAGGTGG - Intergenic
1169492403 20:6082285-6082307 CTGGATTCTCTCAACACAGTAGG + Intronic
1172041573 20:32050346-32050368 CTGGATATTAACAACAGTGATGG + Intergenic
1173971008 20:47152310-47152332 CTGGTAATTCACAATACAGGTGG - Intronic
1175372827 20:58503986-58504008 CTGGAGACTCACACCTCAGGTGG + Intronic
1177529223 21:22338686-22338708 CCTAATATTCACAATACAGGAGG - Intergenic
949143601 3:666894-666916 CTGGAAATTCTCCAAACAGGAGG - Intergenic
951847320 3:27098324-27098346 CTGGACATCCGCAACAGAGGAGG + Intergenic
957100087 3:75816455-75816477 ATGGATATTCCCAACACCTGTGG + Intergenic
957493629 3:80962451-80962473 CTGGTGAATCAAAACACAGGTGG + Intergenic
966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG + Intergenic
974468847 4:62292983-62293005 CTGGATATTTACAGGACAGCTGG - Intergenic
978674090 4:111289509-111289531 ATAGATATTCACAACCCATGGGG + Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
980250423 4:130307822-130307844 CTTGAAATTTACAAAACAGGAGG - Intergenic
980914622 4:139022559-139022581 CCACATATTGACAACACAGGCGG + Intronic
989965268 5:50459603-50459625 TTGGAGAGTCATAACACAGGAGG + Intergenic
989997931 5:50857673-50857695 TTGAATATTTACAACAGAGGGGG - Intergenic
993534534 5:89066360-89066382 CCTGATCTTCTCAACACAGGAGG + Intergenic
994321424 5:98399264-98399286 CTGGAAAGTCTCTACACAGGTGG - Intergenic
996945519 5:129062491-129062513 CTGTATATTAACAAGGCAGGAGG - Intergenic
999691999 5:154156127-154156149 CTGGAACTTCACAAAAGAGGAGG + Intronic
1002667556 5:180836769-180836791 CTGGATAGTGACAACAGAGGTGG + Intergenic
1003393880 6:5736413-5736435 CTGGAGATTGCCACCACAGGTGG + Intronic
1004796232 6:19088608-19088630 CTGGGTGGTCACAGCACAGGTGG - Intergenic
1005338634 6:24822049-24822071 CTGGACATGCACCACCCAGGTGG - Intronic
1007918255 6:45582736-45582758 CTGAATATACACAACAAATGTGG - Intronic
1013847581 6:114472397-114472419 CTGTATATTTTCAACACAGAAGG + Intergenic
1017262463 6:152402875-152402897 ATTGATATCCCCAACACAGGCGG + Intronic
1021832612 7:24630908-24630930 CTGGTTATTGACAACACACTTGG + Intronic
1023627765 7:42133490-42133512 CAGGAAATTCACAGAACAGGAGG + Intronic
1024640561 7:51325352-51325374 CAGGATATTCACATCTCATGAGG + Intergenic
1032072459 7:128816825-128816847 CTGGATAATCCCACCACAAGAGG - Intronic
1032928474 7:136637383-136637405 CTGGCTATTGACATCACAGCAGG - Intergenic
1032996959 7:137457535-137457557 CTGAGTTTTCAGAACACAGGAGG + Intronic
1033203918 7:139400030-139400052 TTGGATATTCAGAAGACAAGAGG - Intronic
1034905743 7:154944311-154944333 CTGCATACCCACATCACAGGAGG + Exonic
1035958857 8:4114412-4114434 CTGCTCATTGACAACACAGGTGG + Intronic
1037428901 8:18788698-18788720 CAGGATATTAAAAACACAGCAGG + Intronic
1040062442 8:43115468-43115490 CAGGATATTGACAAGATAGGTGG - Intronic
1043342825 8:79261719-79261741 CTGCATGTTCTCAACATAGGTGG + Intergenic
1046128462 8:109939991-109940013 CTGGTTATTCAGAACACACACGG + Intergenic
1046676307 8:117112414-117112436 CTGCCAATTCACCACACAGGAGG + Intronic
1048676697 8:136791986-136792008 CTGAATATTCCCCACTCAGGAGG - Intergenic
1051504196 9:17809887-17809909 CTTGATATTCACAATTGAGGAGG - Intergenic
1054713398 9:68533715-68533737 CTGGATACTCTCAAAACATGTGG + Intergenic
1057996766 9:99825950-99825972 CGCGAATTTCACAACACAGGTGG + Intronic
1060898710 9:127238464-127238486 CTTGGGAGTCACAACACAGGAGG + Intronic
1203456228 Un_GL000219v1:170291-170313 ATAAATATTCACAACACAAGAGG + Intergenic
1187045076 X:15639982-15640004 CTGGACATTCACAACAATGGGGG - Intronic
1192125370 X:68497002-68497024 ATGGATATTTACAATACAGCAGG - Intergenic
1192564475 X:72152102-72152124 TTAGAGATTCAAAACACAGGAGG - Intergenic
1193052403 X:77115353-77115375 CTGTATATTCACAACTGTGGTGG - Intergenic
1195098094 X:101525150-101525172 CTGGGTATCCCCAACAGAGGTGG - Intronic
1196624923 X:117867690-117867712 CTGGAAATGCAAACCACAGGAGG + Intergenic
1197785077 X:130190783-130190805 CAGGACATTCACTACCCAGGAGG + Intergenic
1199473612 X:148222067-148222089 CTGTATTTTCCCACCACAGGTGG + Intergenic
1201940820 Y:19457753-19457775 CTTGATATTTGCAACACAGGTGG + Intergenic