ID: 1088475636

View in Genome Browser
Species Human (GRCh38)
Location 11:110235885-110235907
Sequence CTGGGGGACCAGAGAGTTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088475636_1088475642 14 Left 1088475636 11:110235885-110235907 CCGACAACTCTCTGGTCCCCCAG 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1088475642 11:110235922-110235944 TTCTGTGTTCCCAAAGTACTTGG 0: 1
1: 1
2: 0
3: 38
4: 615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088475636 Original CRISPR CTGGGGGACCAGAGAGTTGT CGG (reversed) Intronic
900865570 1:5266470-5266492 CTTGGGGAGCAGGGAGTTGGGGG - Intergenic
901626879 1:10629719-10629741 CTGGGGGCCCAGCAAGTGGTAGG - Exonic
902014327 1:13295139-13295161 CTGGTGTACCAGAAAGTGGTGGG - Intergenic
903012043 1:20338116-20338138 CTGGGGGAGGAGAGAGTTTAGGG + Intronic
903328889 1:22586812-22586834 CTGGGAGCCCAGAGAGGTCTAGG - Intronic
904283016 1:29434525-29434547 CTGGTGGACCACAGAGGTATAGG - Intergenic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
905873233 1:41416675-41416697 CGGGGGCACGAGAGAGATGTGGG - Intergenic
909515937 1:76507427-76507449 TTGGGGGGCCTGAGAGGTGTTGG - Intronic
910117255 1:83745654-83745676 CAGGGGGGCTAGAGAGTTATTGG - Intergenic
910188455 1:84571025-84571047 GTGAAGGACCAGAGAGTAGTAGG + Intronic
912947379 1:114096287-114096309 CTGGGGGAGCTGAGAGATGAGGG + Intronic
913081484 1:115391570-115391592 CCTGAGGACCAGAGAGTAGTGGG - Intergenic
913333619 1:117687355-117687377 CTGGGGGAGAAGGGAGGTGTGGG + Intergenic
914827505 1:151146324-151146346 CTAGGGGACCAGGGAGGTGTCGG - Intronic
915952963 1:160202109-160202131 CTGGGAGAACAGAGAGTGCTAGG + Intergenic
916983627 1:170166891-170166913 CTGGAGGATCAGAGTTTTGTGGG - Intronic
919925039 1:202187778-202187800 CTGGGGGCTCCCAGAGTTGTGGG + Intergenic
920116904 1:203627997-203628019 CTTTGGGACCAGAGATGTGTGGG - Intronic
920378589 1:205522762-205522784 CTGGAGGTCTAGAGAGTTCTGGG - Intronic
921289977 1:213648531-213648553 GTGGGTGGCCTGAGAGTTGTGGG - Intergenic
922561065 1:226569979-226570001 CTGAGGGACCAGTGAGCTGTGGG - Intronic
1063453844 10:6169422-6169444 CTGGGCCACCATGGAGTTGTCGG + Intronic
1069588451 10:69627018-69627040 ATGGGGGACCAGAGGATTGATGG - Intergenic
1070746246 10:78935749-78935771 CTGATGGACCAGAGAGGGGTGGG + Intergenic
1071398746 10:85248739-85248761 CTTGGGAACCAGAGAGATTTGGG - Intergenic
1071501320 10:86206287-86206309 CTGGGAGACCTGAGAGTGGGTGG - Intronic
1071933143 10:90496472-90496494 CAGGGGAAACAGAGAGCTGTGGG + Intergenic
1073323289 10:102628436-102628458 CTCAGGGACCAGTGACTTGTGGG - Intronic
1073893103 10:108123144-108123166 CTGGGGGAACAGAGACTTTGGGG + Intergenic
1074912665 10:117925601-117925623 CTGGTGGCCCAGAGAGTGGGAGG - Intergenic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1076500598 10:130933316-130933338 CTGGGAGACCAGGGAGGTGTTGG + Intergenic
1076607032 10:131695790-131695812 CTGGGGGGACAGAGAGATGCAGG + Intergenic
1078803500 11:14671429-14671451 CTGGGTGGCTAGAGAGTGGTGGG + Intronic
1078981723 11:16542573-16542595 CTGTGGGACCAGTTTGTTGTGGG - Intronic
1079135232 11:17772736-17772758 CTGGGGGCCCAGGGAGATGCTGG + Intronic
1079468935 11:20759819-20759841 CTGGGGGAGCAGAGTGTTCCTGG + Intronic
1080688754 11:34537890-34537912 CTGGGGACTCAGGGAGTTGTTGG + Intergenic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1083306620 11:61765054-61765076 CTGGGGGCCCACAGGGCTGTGGG - Intronic
1084553504 11:69862952-69862974 CCAGGGGACCAGGGAGTTGCTGG - Intergenic
1086742829 11:90388653-90388675 GTGGGGAACCAGTGAGTTCTAGG + Intergenic
1087632144 11:100662286-100662308 CTGGGGAATCAGAGAATTATGGG + Intergenic
1087695246 11:101369401-101369423 CTGGGGGAAGGGACAGTTGTGGG - Intergenic
1088475636 11:110235885-110235907 CTGGGGGACCAGAGAGTTGTCGG - Intronic
1089354307 11:117839918-117839940 CTGGGGGAGCAAAGAGGTGACGG + Intronic
1089541991 11:119194836-119194858 CTGGGGGATTGGAGAGTTGGAGG - Intronic
1090240690 11:125179491-125179513 CAGGGGGAGCATAGAGTTGAAGG + Intronic
1091783583 12:3229223-3229245 TTTCGGGCCCAGAGAGTTGTGGG + Intronic
1091963628 12:4720106-4720128 CCAGGGGACCAGAGCGTTGGAGG + Intronic
1094445620 12:30526666-30526688 ATGGGGCAGCAGAGAGTTCTAGG - Intergenic
1096390998 12:51229006-51229028 CTGAGGGACCAGAGAGAGGCAGG - Intergenic
1096503297 12:52078559-52078581 CTGGGGCATCAGAGAGTTGGAGG + Intergenic
1096522263 12:52191164-52191186 CTGTGGGACCAGAGGCTTGAGGG + Intronic
1097248236 12:57618323-57618345 CTGGGGGACCAGAGGATCATGGG + Intronic
1100354316 12:93814691-93814713 CTGGAGGCTCAGAGAGTTGGTGG - Intronic
1102255175 12:111410839-111410861 AAGGAGGCCCAGAGAGTTGTGGG - Intronic
1103575115 12:121871718-121871740 GGGAGGGACCAGAGAGTTGGTGG + Intergenic
1106099329 13:26681098-26681120 CTGGGGGTGCAGAGAATGGTTGG - Exonic
1106408265 13:29493054-29493076 CTGGGGGAAGAGAGTGTTCTAGG + Intronic
1108088878 13:46824723-46824745 TTGGTGGATCCGAGAGTTGTAGG + Intergenic
1113751810 13:112781643-112781665 CTGGGGGTCCAGCGTGTTTTCGG + Intronic
1118059056 14:62115962-62115984 CAGGGGGCCCTGAGAGTGGTGGG + Intergenic
1118346410 14:64944378-64944400 CTGGAGGCCCAGAGAGTACTAGG - Intronic
1118615625 14:67572780-67572802 ATGGGGCAGCAGAGAGGTGTGGG - Intronic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1122183846 14:99974436-99974458 CTTGGGGATCAGATAGCTGTAGG + Intronic
1122971253 14:105153108-105153130 CTGCAGGACCGGAGAGTTCTAGG - Intronic
1125549538 15:40535046-40535068 CTGGGGGACCAGACTGTGGAGGG + Intronic
1128320678 15:66691725-66691747 CTGGGGGCCCAGAAAGGTTTTGG + Intergenic
1128325723 15:66722811-66722833 CTGGGGGAACAGACAGCTGAAGG + Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1129224921 15:74163641-74163663 CTTCGGGATCAGAGAGATGTGGG + Intergenic
1129937571 15:79463425-79463447 TTGGGGGCCCAGGGAGTTGAAGG - Intronic
1132110067 15:99096391-99096413 CTGGAGTATGAGAGAGTTGTTGG + Intergenic
1132336469 15:101051424-101051446 CTGGGGGGCCTGAGAGGAGTGGG - Intronic
1134202510 16:12210618-12210640 CAGGGGGACCAGAAAGGTGGTGG - Intronic
1134606988 16:15579102-15579124 TTGGGGGCCCAGCCAGTTGTTGG + Intronic
1135424368 16:22324987-22325009 CCTGGGGACCAGAGGGGTGTTGG + Intronic
1136251662 16:29009434-29009456 TTGGGGGATCAGAGAGATATTGG + Intergenic
1136988407 16:35135268-35135290 CTGGGTGTCCAGAGGCTTGTGGG + Intergenic
1137983801 16:53091157-53091179 CTGGGGGTTCAGAGTGTTCTTGG + Intronic
1138438525 16:57020493-57020515 CTGGGGGACAGGAGAGCTGAGGG - Intronic
1139276424 16:65731994-65732016 GTGGAAGACCAGTGAGTTGTGGG - Intergenic
1139466688 16:67157830-67157852 CTGGGAGACCATTGAGCTGTAGG - Intronic
1140739470 16:77928233-77928255 CCTGGTGACCAGAGAGATGTTGG - Intronic
1143705936 17:8697700-8697722 CTGGGGGAGCAGGGAGCTGGGGG + Intergenic
1144772843 17:17769470-17769492 CTGGAGGAGCAGAAAGTAGTAGG + Intronic
1145269716 17:21398311-21398333 CTCGGGTACCAGAGAAGTGTGGG - Intronic
1146148834 17:30448489-30448511 GTGGGGCACAAGAGAGTTTTAGG + Intronic
1147563240 17:41521616-41521638 CTGGGGAACAGGAGAGGTGTGGG - Exonic
1147760789 17:42796294-42796316 CTGGGGGCTCAGAGCGCTGTAGG - Exonic
1147760958 17:42797098-42797120 TTGGGGGAGCAAAGACTTGTGGG + Intronic
1148543904 17:48502416-48502438 CTGGGGGAAAAGAGGGCTGTGGG - Intergenic
1150250852 17:63703752-63703774 CTGGGGGAGAAGAGAGAGGTGGG + Intronic
1150833957 17:68548069-68548091 TTGGGGGAACAGCAAGTTGTTGG + Intronic
1151179163 17:72313247-72313269 CAGGTGGATCAGAGAGTTGCTGG - Intergenic
1151969254 17:77449474-77449496 CTGGGGGGCCAGAAAGCTGGGGG + Intronic
1155317911 18:24590708-24590730 CTGGGGAACCTGAGAACTGTGGG + Intergenic
1156321240 18:36025418-36025440 CTGGGGGAAAAGGGGGTTGTGGG + Intronic
1156734853 18:40243465-40243487 CTGGGGAAACAGGGAGATGTTGG - Intergenic
1159471445 18:68861734-68861756 CTGGGGGCCCACAGAGTATTCGG - Intronic
1160078830 18:75703886-75703908 CTGGGGGTGCAGAGAGCTGTGGG + Intergenic
1160078922 18:75704254-75704276 CTGGGGGAGCAGAGACCTGGGGG + Intergenic
1160837527 19:1131819-1131841 CTGGGGGACCCGAGCGGAGTGGG - Intronic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1162953439 19:14085406-14085428 CCGGGGGACCAGAGGTTTGGGGG + Exonic
1163523785 19:17807995-17808017 GTGGGTGACCATAGAGGTGTTGG - Exonic
1163585832 19:18162944-18162966 CTGGGGGAGGAGAGGGGTGTCGG - Intronic
1164806245 19:31119309-31119331 CTGAGGGACCAGAGATCTTTTGG + Intergenic
1165064076 19:33219063-33219085 ATGGCTGACCAGAGAGATGTAGG + Intronic
1165079673 19:33300166-33300188 CTGGGGGACCAATGAGGTGAGGG - Exonic
1166879704 19:45920344-45920366 CTGGGGGTCCAGAGACGAGTGGG + Intergenic
1167842289 19:52131879-52131901 CTGAGGGGCCAGAGAGTTCTAGG + Intronic
1167868045 19:52344229-52344251 CTGAGGGGCCAGAGAGTTCCAGG - Intronic
1167932171 19:52874837-52874859 CTGAGGGGCCAGAGAGTCCTAGG + Intronic
1167945095 19:52981744-52981766 CTGAGGGGCCAGAGAGTCCTGGG + Intergenic
928918317 2:36498632-36498654 CTCAGGGCCCAGAGACTTGTGGG - Intronic
928934001 2:36655721-36655743 CTAGTGGACCAGAGGGTTGACGG - Intergenic
929158768 2:38811261-38811283 CTGGGGGGCCAGCGAGTAGCAGG + Intronic
929446809 2:42008603-42008625 CTGGGGGCACAGGGAGCTGTTGG - Intergenic
930248129 2:49005588-49005610 CTGGGGGAAGAGAGGGTTTTAGG + Intronic
931630886 2:64297647-64297669 CTGGGGGCCAGGAGAGATGTGGG - Intergenic
932129727 2:69177177-69177199 CTGGGGAACCCGGGAGTTCTTGG + Intronic
932471564 2:71962716-71962738 CTGGGGGGCCAGAGAACTGTGGG - Intergenic
932986408 2:76731140-76731162 GTTGGGGATGAGAGAGTTGTAGG - Intergenic
933477491 2:82809843-82809865 TTGTGGGTCCAGAGAATTGTGGG + Intergenic
934157481 2:89216933-89216955 CTGGGAGACCACAGAATTGTAGG - Intergenic
934209839 2:89965810-89965832 CTGGGAGACCACAGAATTGTAGG + Intergenic
934791789 2:97068326-97068348 GTGGTGGACCAGAGTGTTCTTGG + Intergenic
935606286 2:104974957-104974979 CTTTGGGACCACAGAGATGTGGG - Intergenic
937087152 2:119179030-119179052 CTGAGGCTCCAGAGAGATGTTGG + Intergenic
938771751 2:134506806-134506828 TTGGGGGACCAGAGACGGGTGGG + Intronic
939377285 2:141384965-141384987 CCAGGGGACCAGAGCGTTGGAGG - Intronic
939457172 2:142452540-142452562 CTAGGGGACCAGTGATCTGTGGG + Intergenic
942964845 2:181879506-181879528 CTGGGTGAGGAGAGAGTGGTAGG - Intergenic
944376459 2:199049809-199049831 CAGGGATACCAGAGACTTGTGGG + Intergenic
948349038 2:237323105-237323127 CTTGCGGAGCAGAGAGCTGTGGG - Intergenic
1168860374 20:1042021-1042043 CTGAGGGATCAAAGAGATGTGGG + Intergenic
1170533247 20:17315441-17315463 CTGGAGGGCCAGAGAGTGATCGG - Intronic
1174891694 20:54402230-54402252 CTGTGGGTCCACAGAGTTGAAGG + Intergenic
1175308185 20:57992391-57992413 ATGGGGCTCCAGAGAGGTGTCGG + Intergenic
1175757377 20:61538332-61538354 CTGGTGCACCAGAGATTGGTAGG + Intronic
1178498965 21:33110099-33110121 CTGCGGGTGCAGAGGGTTGTTGG + Intergenic
1178512398 21:33216379-33216401 CTGGGAGACTAGAAAGTTGTAGG + Intergenic
1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG + Exonic
1183227170 22:36558487-36558509 CTGGGGGAGCAGGCAGTTGCTGG + Intergenic
1183742682 22:39677555-39677577 CTGGGAGACCAGACAGCTGAGGG - Intronic
1184128347 22:42502726-42502748 CTGGGGGACAAAAGAGCTGTGGG - Intergenic
1184137139 22:42556041-42556063 CTGGGGGACAAAAGAGCTGTGGG - Intronic
1184456742 22:44615210-44615232 CTGGGGCAGCAGGGAGTTGATGG - Intergenic
1184850081 22:47115012-47115034 CTCGGGGAGCAGGGAGTGGTGGG + Intronic
951027053 3:17841396-17841418 CGGGGGCAGCAGAGAGCTGTTGG - Intronic
952822566 3:37498035-37498057 CTGGGTGGCCAGGGAGCTGTGGG + Intronic
953384632 3:42499610-42499632 ATGGGGGAACAGAGAGTAGGAGG + Intronic
955751020 3:62185520-62185542 CTTGGGGGCCAGAGAGCTGCCGG + Intronic
955920345 3:63948241-63948263 TTGAGGGACAAGAGAGTTGGAGG + Intronic
956157286 3:66312087-66312109 CTGGGGGAACAGGCAGCTGTGGG - Intronic
957981133 3:87511739-87511761 CTGGGGGATCAGAAATTTGGAGG + Intergenic
959439283 3:106357280-106357302 CAGGGACACCAGTGAGTTGTAGG + Intergenic
960498541 3:118406859-118406881 CTAGGGGACCAGAGAGATGCTGG + Intergenic
961468625 3:127097349-127097371 CTGGAGGACCAGGGGGTTGCAGG - Intergenic
961557079 3:127703088-127703110 CTGGGGGAGGAGACAGTGGTGGG - Intronic
962074709 3:132069596-132069618 ATGGGGGACCAGAAGGTTGAAGG - Intronic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
964649037 3:158991165-158991187 CTGGGGGAAGGGAGAGCTGTAGG - Intronic
964813320 3:160689955-160689977 CTCTGGCACAAGAGAGTTGTAGG - Intergenic
966627455 3:182033757-182033779 CTGGGGGCTCAGAGGGTTTTGGG - Intergenic
967866349 3:194193117-194193139 CTGGGGGAAAGGAGAGTTGGAGG - Intergenic
968323366 3:197791249-197791271 CTGGCGGGCCCGAGTGTTGTCGG + Intronic
969089928 4:4686044-4686066 CTGGGAGGCCAGTCAGTTGTGGG + Intergenic
971132319 4:23826329-23826351 CTGGTAGACCAGAGACTAGTAGG + Intronic
971352241 4:25864095-25864117 CTGCGGGCCCAGATAGTTGTCGG - Intronic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
977997549 4:103513643-103513665 CTGGGATGCCAGTGAGTTGTAGG + Intergenic
978664342 4:111164576-111164598 CTGGGGGAAGAGACAGCTGTGGG + Intergenic
980048549 4:128015433-128015455 CTGGGGGACCTGAGAATTCAAGG + Intronic
981884316 4:149654440-149654462 CAGGGGCAACAGAGAGTGGTGGG - Intergenic
982404662 4:155006341-155006363 CTGGGGAAACACAGTGTTGTAGG + Intergenic
985373777 4:189313485-189313507 GAGAGGGACCAGAGATTTGTAGG - Intergenic
989100623 5:37819383-37819405 CTCAGGGACCAGAGAGCTTTAGG - Intronic
989275716 5:39586266-39586288 ATGGTGGACCAGAGTGGTGTTGG - Intergenic
990302443 5:54462224-54462246 GTGGGGGACCTCAGTGTTGTAGG - Intergenic
990982402 5:61614051-61614073 GTGGGGGACCAGGGAAATGTTGG + Intergenic
991492366 5:67195635-67195657 CTGGGTGAGCAGAGCCTTGTTGG - Intronic
992170618 5:74098164-74098186 CTGGAGGACCACTGAGTTGGTGG - Intergenic
993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG + Intergenic
994466935 5:100147921-100147943 CTGAAGGACCATAGAGTTTTTGG + Intergenic
994642834 5:102431581-102431603 CTGGGGTCCAAGAGAGTGGTTGG + Intronic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
996342127 5:122450892-122450914 CTTGGGGTCCTCAGAGTTGTTGG - Exonic
997030045 5:130117046-130117068 CTGGGTGACAAGAGATTGGTAGG - Intronic
1005360185 6:25024078-25024100 CTGGGGGACCAGCGAGTACCAGG + Intronic
1006256444 6:32836251-32836273 CTGGGGCTCCAGAGAATTGTGGG - Intronic
1007111088 6:39313897-39313919 CGCGGGGACCAGAGGGTTGGGGG - Intronic
1007962518 6:45973196-45973218 CTGTGGGACCAGTCAGATGTCGG + Intronic
1009905881 6:69868782-69868804 CTGGAGGACCAGAAAGTAGATGG - Intronic
1011115130 6:83881415-83881437 CTGGGAGACCAAGGAGTGGTGGG - Intronic
1011686794 6:89830024-89830046 CTGGGAAACCAGAGAGTCGGAGG + Exonic
1014048729 6:116926552-116926574 CTGGCGGCCCAGAGAGTTGGTGG + Intronic
1014961704 6:127694836-127694858 TTGGAGGGCCAGAGAGTTGGAGG - Intergenic
1016037233 6:139395947-139395969 CTGGGGCACTTGAGAGCTGTGGG - Intergenic
1016201777 6:141419030-141419052 GTGGGGGAGCAGGGAGTTGGGGG - Intergenic
1019437928 7:1031464-1031486 CCGGGGGACCAGAGACCTGCAGG + Intronic
1019622745 7:2000543-2000565 CTGGGGGACCCGACTGTTGGTGG - Intronic
1020149783 7:5673095-5673117 CCGGAGGTCCAGAGAGTGGTGGG - Intronic
1021491155 7:21221034-21221056 CTGGGGGGCCAGTGAGTAGCAGG + Intergenic
1022511258 7:30936129-30936151 CTGAGGCACCAGTGATTTGTTGG - Intergenic
1022517932 7:30987588-30987610 CTGAGGCACCAGGGACTTGTAGG + Intronic
1024208306 7:47182612-47182634 CTGGGGTTCCAGTGAGTCGTGGG - Intergenic
1024818238 7:53295884-53295906 CTGGGGCACTGGAGAGTGGTGGG + Intergenic
1026535719 7:71237070-71237092 TTGGGGGTCCAGAGAGTGGGAGG + Intronic
1026650711 7:72213803-72213825 CAGGGGGACCTGAGCGTGGTGGG - Intronic
1026914526 7:74111976-74111998 CTCGCGGACCAGGCAGTTGTGGG - Exonic
1028639274 7:93024866-93024888 ATGGGGGATAAGAGAGTTTTAGG + Intergenic
1029425092 7:100489793-100489815 CTAGGAGACCAGAGAGGTGGGGG + Intronic
1031872064 7:127098685-127098707 GGAAGGGACCAGAGAGTTGTTGG - Intronic
1031974606 7:128085787-128085809 GTTGGGGACCAGAGTGTTGGAGG + Intronic
1035794110 8:2337456-2337478 CTGGGGGAAGAGGCAGTTGTGGG + Intergenic
1035798695 8:2384252-2384274 CTGGGGGAAGAGGCAGTTGTGGG - Intergenic
1036093972 8:5702878-5702900 CTGGGGGTCCATACAGTGGTCGG - Intergenic
1037198301 8:16219210-16219232 CTTGAAGACCAGATAGTTGTAGG + Intronic
1040059443 8:43092021-43092043 CCGGGGGACCGGAGCGTTGGAGG + Intergenic
1040743812 8:50615524-50615546 CTAGGTGACCAGGGACTTGTTGG + Intronic
1046580463 8:116086354-116086376 ATGGGGGACCAGAAAGCTCTTGG - Intergenic
1048996107 8:139794593-139794615 CTGGGGGAGCACACAGTTGCTGG - Intronic
1049277763 8:141728448-141728470 CTGGAGGGGCAGAGAGTTGGGGG - Intergenic
1049613546 8:143566916-143566938 CTGGGGGACCCCAAAGTTGGTGG - Exonic
1049917701 9:334462-334484 CTGGGGGCACAGTGAGGTGTGGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050374782 9:4959362-4959384 CTGTGGGAAAAGAGAGTTGGAGG - Intergenic
1051893769 9:21968400-21968422 CTGCTGGACCAGGGAGGTGTGGG - Intronic
1053146916 9:35718251-35718273 CTGGGGGACCAGAACTTGGTGGG - Intronic
1058747287 9:108003928-108003950 CTGGAGGACCAGGGAGCTTTTGG - Intergenic
1058957395 9:109961765-109961787 CTGAAGGATCAGAGTGTTGTAGG + Intronic
1060999135 9:127892884-127892906 CAGGGGGACTAGAGAATGGTTGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062407529 9:136403931-136403953 CTGGAGGACCAGGGAGCTGCAGG - Intronic
1062437619 9:136553560-136553582 CTGGGGGTCCTGAGTGTGGTTGG + Intergenic
1187280613 X:17856058-17856080 CTGGAAGACCAAAAAGTTGTGGG + Intronic
1188928395 X:36074774-36074796 TTGAGGGACCCGAGAGATGTTGG - Intronic
1192343475 X:70282326-70282348 CTGGGAGAGCAGAGCGGTGTGGG + Exonic
1193492795 X:82169623-82169645 CTGTGGTACAAGAGAGTTGTTGG - Intergenic
1193583946 X:83297582-83297604 CTGTGGTACGAGAGACTTGTTGG - Intergenic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1196016233 X:110943673-110943695 CTTGGGGATCAGAGGGTTGAAGG - Intergenic
1198641269 X:138758657-138758679 CTGGGGGACCAGAAAGCTTCAGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1199966374 X:152824148-152824170 CGGGTGGACCAGAGAGATGGAGG - Intergenic
1199975562 X:152893230-152893252 CTGGGGCCCCAGAGAGGTCTGGG + Intergenic
1200269982 X:154673645-154673667 CTGTGGGAGCAGTGAGTTGGAGG - Intergenic
1200982962 Y:9278891-9278913 CCAGGGGACCAGAGAATTGGAGG + Intergenic
1201062066 Y:10055116-10055138 CTAGGGGACCAGAGCATTGGAGG - Intergenic
1202127416 Y:21580818-21580840 CCAGGGGACCAGAGAATTGGAGG - Intergenic
1202151253 Y:21845568-21845590 CCAGGGGACCAGAGAATTGGAGG + Intergenic