ID: 1088478913

View in Genome Browser
Species Human (GRCh38)
Location 11:110273769-110273791
Sequence CAGAAACAGCAAATGAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088478913 Original CRISPR CAGAAACAGCAAATGAAGTG TGG (reversed) Intronic
900000404 1:11791-11813 CAGGAACAGCAAAGGAAATCCGG - Intergenic
900020118 1:182310-182332 CAGGAACAGCAAAGGAAATCCGG - Intergenic
900354843 1:2255789-2255811 CACAAACAGGAAATGAGGTCAGG - Intronic
900774385 1:4571134-4571156 CAGAAATACAAAATGAAGTGGGG + Intergenic
901169793 1:7248350-7248372 CAAATAAGGCAAATGAAGTGGGG - Intronic
902644431 1:17788637-17788659 AAGAAACAGCAAGAGGAGTGGGG + Intronic
903070693 1:20725778-20725800 CAGAAAGAGCCAATGTGGTGAGG + Intronic
903308076 1:22428558-22428580 CAGAAACAACAAAAAAAGTAGGG - Intergenic
904274061 1:29369045-29369067 CAGCCACAGCAAATGAGCTGTGG + Intergenic
904437052 1:30505872-30505894 CAGCAACACAAAATGAACTGAGG + Intergenic
904614785 1:31743852-31743874 AAGAATCAGCAAATGCAGGGAGG + Intronic
904638330 1:31902091-31902113 CAGAAACCGAAACTGAGGTGTGG + Intergenic
905057197 1:35106217-35106239 GAGAAAGAGCAAATGAGATGAGG + Intronic
905872798 1:41414812-41414834 CAGGGACAGCACATGCAGTGTGG - Intergenic
906066017 1:42980621-42980643 GAGGAACAGCAAATGCAGGGAGG + Intergenic
906480364 1:46195514-46195536 CAGAAACAGCCAAGTAAATGTGG - Intronic
907180770 1:52568179-52568201 GAGAGAGAGCGAATGAAGTGGGG - Intergenic
907660228 1:56384953-56384975 CAGATACAGTAACTGAAGTTTGG + Intergenic
908809378 1:67964164-67964186 TAGAAACAGGAGATAAAGTGAGG + Intergenic
908867899 1:68572432-68572454 CAGAAACAGCATATACAATGAGG - Intergenic
909437676 1:75662197-75662219 CAGCAACATGAATTGAAGTGGGG + Intergenic
909695200 1:78460498-78460520 CAAAAACAAAAATTGAAGTGTGG - Intronic
909802028 1:79821851-79821873 TAGAAAAAGCAGATAAAGTGTGG + Intergenic
911594471 1:99784701-99784723 AAGAAACAGAAAAAGAAATGTGG - Intergenic
911729297 1:101276300-101276322 TAGTAACAGCAAAAGAAGTGGGG + Intergenic
912060651 1:105664319-105664341 ACTACACAGCAAATGAAGTGTGG + Intergenic
912086506 1:106013122-106013144 CAGGAGCAGGAAACGAAGTGGGG + Intergenic
912410197 1:109475972-109475994 CAGAAAGAGCCAATGCAGTTTGG + Intronic
914859734 1:151375974-151375996 CAGAAACAGTGCATTAAGTGTGG - Intergenic
915944828 1:160141939-160141961 AGGAAACAACAAAGGAAGTGAGG + Exonic
916509731 1:165461423-165461445 CAGAAACAGGGAAAGAAGTTAGG - Intergenic
916974977 1:170066552-170066574 GAGAAAAAGAAAATGAAGAGAGG + Intronic
917609009 1:176667395-176667417 CAGAAAAATGAAAGGAAGTGGGG + Intronic
917694457 1:177507442-177507464 TTGAAGTAGCAAATGAAGTGAGG - Intergenic
917765264 1:178209157-178209179 CAAAAACAGCAAAATATGTGTGG - Intronic
919246338 1:194990613-194990635 CAGAAAAAGGAAAGGAAATGAGG + Intergenic
919684768 1:200473487-200473509 CTGAAACAGCAAAGAAAGTTGGG - Intergenic
920798499 1:209163756-209163778 CAGAAACAGCAAAAGTGGTGGGG - Intergenic
921073739 1:211683608-211683630 CAGAAAGAGCAAATAAGGTAAGG + Intergenic
921554052 1:216575649-216575671 CAGAAACAGGAGTGGAAGTGGGG + Intronic
921640805 1:217551178-217551200 CAGAAACAGAAAAAGATGTATGG + Intronic
922755318 1:228093368-228093390 CAGAAGCAGTAAATGATGTAGGG + Intronic
923166591 1:231369760-231369782 CAGATACAGCAAATGAATGCCGG + Intronic
924434181 1:244024118-244024140 CACAAAGAGCAAATTAAGTATGG - Intergenic
924474055 1:244367835-244367857 CAGAAAGAGCAAACGCTGTGGGG + Intronic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1063366660 10:5494830-5494852 CAGAAAAAGGAACAGAAGTGTGG + Intergenic
1063500716 10:6551250-6551272 CAGAAACAGAAAACCAAATGTGG - Intronic
1064280877 10:13950558-13950580 CAGAAGGAGCAAGTGAGGTGGGG + Intronic
1064728042 10:18301161-18301183 CAGAAACAGCAAATGGTGTCAGG - Intronic
1064771638 10:18729497-18729519 CAGAAACAGAAAACGGAATGCGG + Intergenic
1064835219 10:19519873-19519895 CATACAAAGCAAATGAAGAGGGG + Intronic
1065924180 10:30421314-30421336 CAGTAACAACTAATGAATTGAGG + Intergenic
1067158379 10:43801788-43801810 TAGAAACAGCAAAGGATTTGCGG - Intergenic
1068102343 10:52571204-52571226 CAGAAGGAGCAAATGACTTGGGG + Intergenic
1068871028 10:61944951-61944973 TAGAAACAGAAATTGAACTGAGG - Intronic
1069294287 10:66824867-66824889 AAGAAAATCCAAATGAAGTGTGG + Intronic
1069407629 10:68119019-68119041 CAGAAACAGAAAATTAAACGAGG + Intronic
1072745820 10:97938471-97938493 CAGAAAAGGAAACTGAAGTGAGG + Intronic
1073159417 10:101377099-101377121 CAAAAACATAAAATGAAGTGAGG - Intronic
1073379856 10:103069808-103069830 CAAAAACACCAAATGATGTGCGG + Intronic
1073949355 10:108787968-108787990 GAGAAACAACAAATGCAGTAGGG - Intergenic
1073950376 10:108801842-108801864 CAGAACAAACAAGTGAAGTGTGG - Intergenic
1074324490 10:112435849-112435871 CAGAAACACTCAATGAAGTTAGG + Intronic
1074693898 10:116030476-116030498 CAGGAACAGAACAGGAAGTGAGG - Intergenic
1078322478 11:10349064-10349086 AACTCACAGCAAATGAAGTGTGG + Intronic
1078370697 11:10742310-10742332 CAGAGACAGAATTTGAAGTGGGG - Intergenic
1078376128 11:10794746-10794768 CAGGAGCAGCAAATCCAGTGTGG + Intergenic
1078620100 11:12899329-12899351 CAGAAACACAAAATGGAATGGGG - Intronic
1079589137 11:22160981-22161003 CAGAGACAGCAAATGGAATATGG - Intergenic
1080398835 11:31915428-31915450 CACAGGCAGCAAATGAGGTGGGG + Intronic
1080593384 11:33744320-33744342 CACAAACAGCAGATGCAGAGAGG + Intronic
1081287994 11:41296073-41296095 CAGAAAGGGAGAATGAAGTGTGG + Intronic
1081597515 11:44469200-44469222 CAGACACAGCCAATGAAGAGGGG + Intergenic
1083373793 11:62203401-62203423 CAGAAACAGGATATGAAGCCAGG - Intergenic
1083379648 11:62254891-62254913 CAGAACCAGGATATGAAGTCAGG - Intergenic
1083887801 11:65581298-65581320 CAGAACGAGCTAATGAAGCGGGG + Exonic
1085417734 11:76330398-76330420 CAGGAACAGCAAAGGGCGTGAGG - Intergenic
1085450711 11:76630416-76630438 CAGGAACAGCAAATGCAGAGAGG - Intergenic
1088305027 11:108398744-108398766 TATTAACAGCAAAGGAAGTGTGG - Intronic
1088478913 11:110273769-110273791 CAGAAACAGCAAATGAAGTGTGG - Intronic
1090101969 11:123807190-123807212 CTGACAAAGTAAATGAAGTGAGG - Intergenic
1091108969 11:132947641-132947663 TAGAAACAGAAAATGAGCTGAGG + Intronic
1091331519 11:134735063-134735085 CAGAAACAGGAAATGAATAAAGG - Intergenic
1091373495 12:11922-11944 CAGGAACAGCAAAGGAAATCCGG - Intergenic
1091480877 12:829315-829337 CAGACACAAGAAATGTAGTGAGG - Intronic
1091933346 12:4414989-4415011 CAGAGTCAGAAAATGAACTGGGG + Intergenic
1091997210 12:5002970-5002992 CAGGGACAGCCAAGGAAGTGAGG + Intergenic
1092891589 12:12974203-12974225 TAGAAACAGCAAATGGGGTGTGG + Intergenic
1093304031 12:17489942-17489964 CAAAAACAGTGAATGAAGAGAGG + Intergenic
1093562760 12:20562086-20562108 CAGTAATACCAAATGAAGTCAGG + Intronic
1093987786 12:25556439-25556461 CAGAAACAGCAAGTACAGTGAGG - Intronic
1094170929 12:27491075-27491097 CAGGAATAGCAAATAAAATGTGG + Intronic
1095204179 12:39420543-39420565 CAGAAACAGCAAAGTGAGTATGG + Intronic
1097158879 12:57031646-57031668 GAGAAAGAGCAAATGAATTCAGG + Intronic
1098028427 12:66230326-66230348 CAGGGACAGCAAATGAAGCGAGG + Intronic
1098036862 12:66312157-66312179 CAGAAACGCCAGTTGAAGTGTGG + Intronic
1098818191 12:75194950-75194972 AAGAAAGAGCAAAGGTAGTGAGG - Intronic
1098874502 12:75853137-75853159 CAGAAACTGCATACTAAGTGTGG + Intergenic
1099024165 12:77444620-77444642 AAGAAGCAGCAAATAAGGTGGGG + Intergenic
1099858423 12:88200436-88200458 CAGAAAGAGAAAAAGAAGAGTGG - Intergenic
1100175232 12:92022876-92022898 AAATGACAGCAAATGAAGTGTGG + Intronic
1101584012 12:106068434-106068456 CAGAGACAGAACATGGAGTGTGG + Intronic
1102149711 12:110680319-110680341 CAGAGACAGCAAGGGAAGTAGGG - Intronic
1102758297 12:115362981-115363003 GAGAACCAGCAAAAGAAATGAGG - Intergenic
1103652621 12:122444619-122444641 CAGAAAAAGAAAAAGAAATGGGG - Intergenic
1103692969 12:122790754-122790776 CAGAAACACCAAGTGAAGACAGG - Intronic
1104060350 12:125262803-125262825 CAGCAACAGTAAATGAACAGAGG - Intronic
1104268695 12:127262564-127262586 CAGAAAGAGCAAATGAGCTCAGG + Intergenic
1105999252 13:25704293-25704315 CAGAAACTGGAGCTGAAGTGAGG - Intronic
1106182758 13:27382504-27382526 CACAAACAACAAATTACGTGGGG - Intergenic
1106328497 13:28717368-28717390 CAGAAACAGTAAAAGGATTGGGG + Intronic
1107193801 13:37622949-37622971 AAGAAACAGCAAATGAGGCCGGG + Intergenic
1108457723 13:50633481-50633503 CAGAAACAGGAAAGGAAGCTGGG - Intronic
1108936190 13:55883729-55883751 AAGTAACTGCAAATAAAGTGGGG - Intergenic
1108968846 13:56346330-56346352 CAGTAATAGAAAATGAAGTGGGG - Intergenic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109627732 13:64998045-64998067 GAGAAGCAGCAAAAGAAATGAGG + Intergenic
1109727399 13:66360977-66360999 CACTGAGAGCAAATGAAGTGGGG + Intronic
1111010146 13:82301870-82301892 AAGAAGCGCCAAATGAAGTGGGG + Intergenic
1111370767 13:87313637-87313659 AAGCAAGAGCAAATGAGGTGGGG - Intergenic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1113070291 13:106413909-106413931 AAGAGACAGCAGATGGAGTGGGG - Intergenic
1113255937 13:108504840-108504862 TAGAAACAGCAAATAGAATGTGG - Intergenic
1114153804 14:20076230-20076252 CAGAAACAGAAAATGTGTTGTGG + Intergenic
1114737774 14:25060173-25060195 CAGAAAAAGTAGATGAAGGGTGG + Intergenic
1115813764 14:37140158-37140180 CAGAAAGAAGAAATGCAGTGAGG - Intronic
1117870133 14:60191984-60192006 CAGACTCAGCAAATGAGCTGTGG + Intergenic
1117925303 14:60772846-60772868 CTGAATAAGCAAATGAAGTAAGG + Intronic
1118451875 14:65910425-65910447 CAAAAACAACAAATTAATTGGGG - Intergenic
1118489252 14:66243385-66243407 AAGAAACAGGCAAGGAAGTGGGG + Intergenic
1119201652 14:72757142-72757164 TAGGAACAGCAATTGAAATGGGG + Intronic
1120496147 14:85238787-85238809 CAGAAAAGGTAAAAGAAGTGTGG + Intergenic
1122188009 14:100016691-100016713 CAGAAACAGAAACATAAGTGAGG - Intronic
1122304599 14:100754253-100754275 CACAAACAGCAAGTGAAGGTGGG + Intergenic
1123996395 15:25720903-25720925 CAGAAACAGCAAATTAAAACCGG - Intronic
1125134550 15:36326735-36326757 AACAAGCAGCATATGAAGTGAGG - Intergenic
1125395219 15:39240163-39240185 TAGAAGCAGGACATGAAGTGTGG + Intergenic
1125881613 15:43200494-43200516 CAGAAACACCAAAAGAAAAGTGG + Intronic
1128648362 15:69393267-69393289 CAGAGACAGGGAATGAAGAGAGG - Intronic
1130389334 15:83441619-83441641 CTGAAACAGCAAATGAACCAGGG - Intergenic
1130425729 15:83797310-83797332 CTGAAAAAGCATATGAAATGAGG + Intronic
1130659110 15:85816007-85816029 CAGACAAAGAAAATGGAGTGTGG + Intergenic
1130807870 15:87345633-87345655 AAGAAAGAGCAATGGAAGTGGGG + Intergenic
1131347465 15:91663916-91663938 CAGCAAAAGCAAAAGAAATGTGG + Intergenic
1132331105 15:101013050-101013072 CAGAAGCAGCAAATCAGGAGAGG + Intronic
1132453103 15:101979154-101979176 CAGGAACAGCAAAGGAAATCCGG + Intergenic
1132453791 16:11472-11494 CAGGAACAGCAAAGGAAATCCGG - Intergenic
1133652499 16:7825925-7825947 CAGAAATAGAAAATGATATGTGG - Intergenic
1135465423 16:22680783-22680805 CACAAACACCTAATGAAATGTGG - Intergenic
1136076604 16:27821529-27821551 CAGAAACAGAAAAAGAAATATGG - Intronic
1138096853 16:54218708-54218730 CAGAGACAGCAGGTGCAGTGGGG + Intergenic
1138258533 16:55594225-55594247 TAGAAACAGCAGGTGAAATGTGG + Intergenic
1138920483 16:61522532-61522554 CAGAAACAGAAACTCCAGTGAGG + Intergenic
1139353089 16:66350120-66350142 AAAAAAAGGCAAATGAAGTGAGG + Intergenic
1140082074 16:71757682-71757704 CAGAGTCAGAAAATGAAATGAGG + Intronic
1142915827 17:3136813-3136835 CAGTAACATCAAATGAAATTAGG - Intergenic
1143882900 17:10043348-10043370 CAGAGAAACCAAATGAAGAGGGG + Intronic
1143963866 17:10742080-10742102 CAGAAACTGCATAGGAAATGGGG - Intergenic
1144633286 17:16887077-16887099 CAGAAGCAGCATAAGAAGTTGGG + Intergenic
1147189612 17:38730858-38730880 CAGAAACAGGAAATGGAGCTAGG + Intronic
1148087130 17:45001046-45001068 CAGGAGCAGCAAAGGGAGTGGGG + Intergenic
1149109946 17:53017029-53017051 CAGAAACAGTAAAGGTAGTTGGG + Intergenic
1149669138 17:58390120-58390142 CAGAATCAGCAAAGAAAATGTGG + Intronic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1150509920 17:65739817-65739839 AAGAAACAACAGATGAAGTAAGG - Intronic
1150657272 17:67047575-67047597 CAGAAACAGCTTCTCAAGTGGGG - Intronic
1150832364 17:68535562-68535584 GAGAGACAGTGAATGAAGTGGGG + Intronic
1150934683 17:69622814-69622836 CAGAAACAGGCAATGAGTTGAGG - Intergenic
1151393824 17:73806066-73806088 CAGAAAAACCAAATAAAATGAGG + Intergenic
1151416748 17:73971364-73971386 AAGAAACAGCAAGTGCAGCGTGG + Intergenic
1152514722 17:80816648-80816670 CAGATTCAGCAAATGAAGAAAGG + Intronic
1154090938 18:11362498-11362520 CAGAAAAAATAAATGAATTGTGG + Intergenic
1156587327 18:38445722-38445744 CAGAAACATCCAGTGAAGTGTGG + Intergenic
1156603802 18:38641932-38641954 AAGAAACAGCAAATACAGAGTGG - Intergenic
1156894029 18:42223757-42223779 GAGAAACAGCAAATGCAGGAGGG - Intergenic
1157568119 18:48693793-48693815 CAAAAACAGCTACAGAAGTGTGG - Intronic
1157687851 18:49657266-49657288 CAGAAACAGGCAGTGAGGTGGGG - Intergenic
1158030476 18:52958531-52958553 AAGAGACAGGAAAAGAAGTGAGG + Intronic
1158161277 18:54486526-54486548 CTGAACCAGTAAATGAAGAGGGG + Intergenic
1158606321 18:58899429-58899451 CAGAAAGAGGAAATGCAGAGAGG - Intronic
1159998872 18:74996465-74996487 TAGAAAAAGGAAATGAAGTCAGG + Intronic
1161030679 19:2056505-2056527 GACAAACAGGAAATGAGGTGTGG + Intergenic
1161131741 19:2594072-2594094 CAGAAACTGCAAATCAAGGCCGG + Intronic
1161274259 19:3406780-3406802 CAGAATCTGCACTTGAAGTGAGG - Intronic
1161474512 19:4476862-4476884 CAGAAACCTCAAAAGCAGTGTGG - Intronic
1162061292 19:8097012-8097034 AAAATACAGCAAATGAGGTGGGG + Intronic
1163427780 19:17248455-17248477 CAGAAACAGAACAAGAAGTATGG - Intronic
1163487848 19:17599555-17599577 CAGAAACAGCTAATGAGCAGGGG + Intergenic
1164584480 19:29458110-29458132 CAGAAAAAGCATCTGAAATGAGG - Intergenic
1164873934 19:31669940-31669962 CACAAACAACAAAGGCAGTGGGG - Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165661717 19:37586651-37586673 AAGAAACAGCAACTCACGTGGGG + Exonic
1166441863 19:42822710-42822732 CAGAAAAAGGAAATGTAATGGGG + Intronic
1166851511 19:45763648-45763670 CAGAGACAGCAAAAGAATTGAGG - Intronic
1166911243 19:46159747-46159769 CAGAAACTGCAAAACAAATGAGG + Intronic
1167029173 19:46945793-46945815 CAGAAACAGGGAACGAAGTCTGG - Intronic
1168384940 19:55955274-55955296 CTGAAACAGCAAATGGAGAGAGG + Exonic
1168447243 19:56430703-56430725 CAGAAACAGCAACAGTAGTCAGG + Intronic
925704036 2:6667202-6667224 CAGAGAGAGCAACTGAAGAGTGG - Intergenic
926550156 2:14291681-14291703 CAGAGACAGCAAATGCAATTTGG - Intergenic
926609349 2:14930236-14930258 CAGAAGCAGCACACAAAGTGAGG + Intergenic
926768323 2:16344836-16344858 CAGAAGCTGCAAATGGTGTGTGG + Intergenic
926796689 2:16625403-16625425 AAAAAACAGGAAGTGAAGTGGGG + Intronic
926960893 2:18357401-18357423 CAGAGACATGAAATAAAGTGTGG - Intronic
927862037 2:26566084-26566106 CAGAAACAGAGAATGAGGAGTGG - Intronic
927889717 2:26740780-26740802 AAGAAACAGCCAAAGAAATGGGG - Intergenic
928130770 2:28648489-28648511 TAGACACAGAAAAGGAAGTGAGG + Intergenic
929101326 2:38317368-38317390 AAGAAACACCAAATGACATGTGG + Intronic
929139242 2:38652685-38652707 CAGAAACAGAAAATGAAAAGTGG - Intergenic
929381228 2:41356572-41356594 CACAAACAGAAGATGAAGTTTGG + Intergenic
930586531 2:53273925-53273947 GAGAAAAAGAAAATGAAATGGGG + Intergenic
931527587 2:63173776-63173798 CATTAACAGCAAATAAAGAGGGG - Intronic
932516840 2:72359909-72359931 GAGAACCAGCAAGAGAAGTGGGG - Intronic
932757098 2:74416440-74416462 CAGATAAAGAAACTGAAGTGGGG + Intronic
932842733 2:75098954-75098976 CAGAACCAGCAGGTGGAGTGAGG + Intronic
933224239 2:79726978-79727000 CACAAACAGCAAATGAAAACCGG + Intronic
933331168 2:80895084-80895106 CACAAACAGGAGATGGAGTGGGG - Intergenic
933405612 2:81854186-81854208 CAGAAAAACCAAATACAGTGTGG + Intergenic
935694108 2:105756245-105756267 TAGAAACAGCACAGGAAGAGAGG - Intronic
936569319 2:113601626-113601648 CAGGAACAGCAAAGGAAATCCGG + Intergenic
937608797 2:123835405-123835427 CAGAAACATCATATGAAATGAGG + Intergenic
937959072 2:127440846-127440868 GCGAATCAGCAAATGAACTGGGG + Intronic
938609911 2:132936860-132936882 CAGAAGCAGATAATGAAATGAGG + Intronic
938712352 2:133986260-133986282 CAGAGGCAGCAATTGGAGTGAGG - Intergenic
939172547 2:138712396-138712418 CAGAAACAGGAAATGATCTTTGG - Intronic
939950002 2:148458747-148458769 CAGACACAGAAAATGAATGGAGG + Exonic
940031743 2:149271070-149271092 AAGAAACACCAAGTGTAGTGTGG - Intergenic
940461490 2:153968383-153968405 AAGGGACAGCAAAGGAAGTGTGG - Intronic
940647353 2:156405533-156405555 CAGAATTAGCAAAAGAAGTGGGG - Intergenic
941013309 2:160325955-160325977 CAGAACAACCAAATGAAATGGGG - Intronic
941115807 2:161470925-161470947 CAAAAATAGCAAGTGGAGTGGGG + Intronic
941386747 2:164861534-164861556 AAGAAACAGTACAAGAAGTGTGG - Intergenic
942964744 2:181878319-181878341 TAGAAACAGCAAATGTAGACAGG - Intergenic
943065302 2:183079744-183079766 CACAAATAGCAAATGAAGCAAGG + Intronic
943278415 2:185898337-185898359 CAGAAACAGCAAGTCCAGTTTGG - Intergenic
943314750 2:186373217-186373239 CATAAACAGCATATGAACTGTGG - Intergenic
944172274 2:196793130-196793152 GAGAAACATCAGATGGAGTGAGG - Exonic
945009955 2:205450402-205450424 TAGAAACAGAAAAGCAAGTGAGG + Intronic
945072267 2:206003922-206003944 AAGAGACAGCAAATGGTGTGTGG - Exonic
945372810 2:209041136-209041158 TAGAAATAGAAAATAAAGTGAGG + Intergenic
946572392 2:221039261-221039283 CAAAAACAGGAAATGAACCGTGG - Intergenic
946619225 2:221543405-221543427 CATAAAAAGCAAAATAAGTGTGG + Intronic
947640385 2:231704482-231704504 CAGAAACAGCAAAAGAGGGCCGG + Intergenic
947640492 2:231705128-231705150 AAGAAACAGCAAAAGAGGTAGGG + Intergenic
947834671 2:233166686-233166708 CAGAAACAGCAAATGCTGGTCGG + Intronic
947890735 2:233617008-233617030 CAGATACATCACATGCAGTGGGG - Intergenic
948212386 2:236204260-236204282 CTGACACAGCAAGTAAAGTGAGG - Intronic
948511235 2:238466606-238466628 CAGAAGCAGCATCTGAAGTGGGG - Intergenic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
1169238247 20:3950369-3950391 CAGAGACAGAGACTGAAGTGAGG + Intronic
1169529755 20:6472369-6472391 CAAAAACAGAAAATATAGTGGGG + Intergenic
1170587683 20:17747386-17747408 AAAAAAAAGCAAAGGAAGTGAGG + Intergenic
1173531844 20:43775695-43775717 CAGAAACAGTACATGGAGTTTGG + Intergenic
1177405716 21:20665231-20665253 CAGAATCAGCATCTGAAGTCAGG - Intergenic
1178540159 21:33442618-33442640 CATAAACATCAAATGATATGTGG + Intronic
1178743186 21:35222675-35222697 CAGAAACAGGAAATGCAGCCAGG - Intronic
1179272221 21:39860387-39860409 CAGGAGCAGAAAATGAAGTTGGG - Intergenic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1182006391 22:26963494-26963516 CAGAAACGGCCAAAGAAGGGGGG - Intergenic
1182920171 22:34072073-34072095 CAGACAGAGAGAATGAAGTGGGG + Intergenic
1183003828 22:34883738-34883760 CAGAAACACCAAATGTCTTGGGG + Intergenic
1184116068 22:42423121-42423143 AAAAAAAAGGAAATGAAGTGAGG + Intronic
1184922892 22:47618237-47618259 CAGAAACCTCAAGTGAAGTGGGG - Intergenic
1185219034 22:49619807-49619829 AAGAAACAGCAAAAGAACTCAGG + Intronic
949482119 3:4503815-4503837 AAAAACCAGCAAATGAAGTTAGG - Intronic
950075672 3:10185170-10185192 CCGAATCAGCAGATGAGGTGGGG - Intronic
951117753 3:18885656-18885678 CACAAAGTGCAAATGCAGTGGGG + Intergenic
951941666 3:28086325-28086347 CTGAAACAGCCACTGAAGGGTGG + Intergenic
952710111 3:36422053-36422075 CTGAAACATAAAATGAAGTCAGG - Intronic
953784408 3:45899840-45899862 CGGAAACAGGAAATGAGGTCTGG - Intronic
954061666 3:48072875-48072897 GAGAAACAAGAAATGAAGTATGG + Intronic
954287337 3:49628408-49628430 CAGAAACAGCAGATGAGATCTGG + Intronic
954290839 3:49649182-49649204 CAGAGGCAGCATGTGAAGTGAGG + Intronic
954365316 3:50142953-50142975 AAGAAAAAGAAAAAGAAGTGTGG - Intergenic
954445627 3:50545301-50545323 CAGAAAAATCAAGTGAAGGGTGG - Intergenic
955727577 3:61949455-61949477 GAGAAACCACAATTGAAGTGAGG + Intronic
956710859 3:72037550-72037572 CAGAAACAGAAAAGGAAGGAAGG - Intergenic
959531666 3:107440524-107440546 CAGAAACAGCCAGTGACATGCGG + Intergenic
959677807 3:109056078-109056100 GAGAAACAGGAAATGCAGAGAGG + Intronic
960295065 3:115933020-115933042 AAGAAAGAGAAAATAAAGTGGGG + Intronic
963077922 3:141365240-141365262 AAGCAACAGCAAATGAACTAAGG - Intronic
963313270 3:143731445-143731467 GAGACACAGGAAATGAAGTGAGG - Intronic
964404193 3:156331289-156331311 CAGACACAACTAATGAAGAGTGG + Intronic
964512651 3:157469937-157469959 TAGAAGCAGAAAATGAACTGAGG - Intronic
965821272 3:172686750-172686772 GAGAAAATGCAAAGGAAGTGCGG - Intronic
966154494 3:176901227-176901249 CAGAAAGAGAAAAAGAAGAGAGG + Intergenic
967370048 3:188734445-188734467 CACAAATAGCAAGTTAAGTGGGG - Intronic
968913235 4:3486185-3486207 CAGCCACAGCCAAGGAAGTGTGG - Intronic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
970087061 4:12361636-12361658 CAGAAACACCAAATGTGGAGAGG + Intergenic
970139503 4:12966287-12966309 CATAAACAGAAAATGAAGGCTGG - Intergenic
970496955 4:16635900-16635922 CAGAAACAACAAATCCAGCGAGG - Intronic
970682942 4:18532487-18532509 CAGAAGTAGAAAATGGAGTGAGG - Intergenic
971145104 4:23967923-23967945 CAGAAAAAGCAAATTAAAGGAGG + Intergenic
971985293 4:33814450-33814472 GAGAAACAGAAAATGAAATGAGG + Intergenic
972048583 4:34700189-34700211 AAGCAAGAGCAAATGAAATGAGG + Intergenic
972342793 4:38167051-38167073 CAGTGACAGGAAAGGAAGTGAGG + Intergenic
972650802 4:41015819-41015841 CAGAAACAGAGAATGTAGTGTGG + Intronic
972873300 4:43327331-43327353 GAGAAACAGCAGATGAAGGAAGG - Intergenic
972940570 4:44190270-44190292 GAGTAATAGAAAATGAAGTGTGG - Intronic
973222125 4:47738562-47738584 CAGAAACAGCAACTAATGTTGGG + Intronic
974145578 4:57943400-57943422 CAGACAAAGCAAATGATGTCTGG + Intergenic
975896466 4:79098263-79098285 CAGCTACAGCAAATGATGTAGGG - Intergenic
976426795 4:84913432-84913454 CAGATACAGCAAAAAAGGTGAGG + Intronic
977447529 4:97149624-97149646 CAGAAACAGAAACAGTAGTGAGG - Intergenic
977574700 4:98663602-98663624 CAGAAACAGCTAGGGAAGAGAGG - Intergenic
977660804 4:99583069-99583091 CACAAAAAACAAATGAAGAGTGG + Intronic
978643056 4:110893860-110893882 CAGAAAGAGTGAATAAAGTGGGG - Intergenic
979304224 4:119123916-119123938 CAGATAGAGAAAAAGAAGTGAGG - Intergenic
979392675 4:120144871-120144893 CAGAAAGAGCAAGTCATGTGGGG - Intergenic
979786612 4:124722761-124722783 CAGAAACAGAAAATAAAGTATGG + Intergenic
982614033 4:157617269-157617291 CAGAATCAGCAAATTTAGGGTGG + Intergenic
982952995 4:161724199-161724221 AAGAAAATGCAAATGAAGAGAGG + Intronic
985038359 4:185863691-185863713 CAGAAACTGTAATTGGAGTGTGG + Intronic
985085202 4:186306110-186306132 CATAAGAAGCAAGTGAAGTGGGG - Intergenic
985131741 4:186745491-186745513 CAGAGCCAGCAAATGAAATATGG + Intergenic
986239339 5:5943554-5943576 CACAAATAGCAAGTGAAGAGGGG - Intergenic
986415330 5:7522446-7522468 CAGAAACAGGAAGTGAAGGCTGG - Intronic
987966513 5:24883335-24883357 GAGAAACAGCAAATAAACCGAGG - Intergenic
988973753 5:36495041-36495063 GATAAACATCAAAAGAAGTGTGG - Intergenic
989352269 5:40499934-40499956 CAAAAACACCAAATGAAGATTGG + Intergenic
989543177 5:42641648-42641670 CAGAAAAAGCAAAGTAGGTGGGG - Intronic
990302053 5:54459137-54459159 CAGAGCCAGCAGATGAAATGCGG - Intergenic
990375742 5:55168716-55168738 CAGAAACAGAAAATCAATTACGG + Intronic
990681508 5:58249807-58249829 CAGAAACAGCAAAACAGGAGGGG - Intergenic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
990756206 5:59073482-59073504 AAGATACAGAAAATAAAGTGGGG + Intronic
991353663 5:65746273-65746295 CAGAGACATCAAATGAAAAGAGG + Intronic
991573424 5:68078776-68078798 CAGAGACAGCAAATGTCATGAGG + Intergenic
993132038 5:83911101-83911123 AAGAAACAGGAGATGGAGTGAGG - Intergenic
993820450 5:92608537-92608559 TACAAACAGCGAATGGAGTGAGG - Intergenic
994390514 5:99187077-99187099 CAGCACAAGCAAATAAAGTGAGG - Intergenic
994581542 5:101648791-101648813 CAGAAACAGCAGAGCAAATGGGG + Intergenic
995574512 5:113514608-113514630 CAGAACCAGCAACTGACCTGCGG + Intronic
995919957 5:117299827-117299849 AAGAAAAAGAAAATGAGGTGGGG + Intergenic
996080345 5:119252331-119252353 AAGAAACAGCAAATGAAGCGAGG + Intergenic
996380875 5:122861507-122861529 ATGAAATAGCAAATGAAGTGAGG - Intronic
997121495 5:131177890-131177912 CAGAAACAGAAATTGAGGAGAGG - Intronic
998580828 5:143373979-143374001 CAGAAAGAGTAACTGAAGTTAGG - Intronic
998585791 5:143426033-143426055 CCATAACAGGAAATGAAGTGTGG + Intronic
1000601333 5:163278813-163278835 CAATAATAGCAAATGAATTGAGG + Intergenic
1000637591 5:163661562-163661584 CAGCAACAGCAGATGAACTATGG + Intergenic
1001769956 5:174287447-174287469 CAGAAACACCAAATAAAGTGAGG + Intergenic
1004043812 6:12008598-12008620 CAGAACCTGCAAGTGAAGTGCGG + Intergenic
1005526517 6:26656816-26656838 CCTAAACAACCAATGAAGTGTGG + Intronic
1006102342 6:31693330-31693352 GAGATACAGCAAAAGAACTGGGG + Intronic
1007713687 6:43841000-43841022 CACAAGGAGCAAATGACGTGTGG - Intergenic
1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG + Intergenic
1008021380 6:46581805-46581827 CAGAAACAGCAATTCAAGAGTGG - Intronic
1008539296 6:52533055-52533077 CAGAGACAGAAAATGGAATGGGG + Intronic
1010512954 6:76743347-76743369 CAGAAAAAGCTAATGCACTGAGG - Intergenic
1013056096 6:106584280-106584302 CGGAAACAGCAAACGAGCTGAGG + Intronic
1013092314 6:106911466-106911488 CAGAAACAGCACTTCAAGGGAGG + Intergenic
1013410201 6:109877017-109877039 CAGAAGCCGCAAGTGAAATGAGG + Intergenic
1015722635 6:136259992-136260014 CAAAAACTGCAACTGAAATGGGG + Exonic
1016359952 6:143256705-143256727 TACAAACTGCCAATGAAGTGGGG - Intronic
1017289671 6:152721233-152721255 CAGAAAGAGCAAAGGAAGTGAGG + Intronic
1017619471 6:156281018-156281040 AAGAAACAGGAAATGAATGGAGG - Intergenic
1018393932 6:163362557-163362579 GTGAAAATGCAAATGAAGTGAGG + Intergenic
1019043363 6:169124370-169124392 CAGAAATAACAAGTGAAATGTGG - Intergenic
1019091002 6:169533569-169533591 CAGAAACAGAAAAGGCAGAGAGG + Intronic
1020478102 7:8623013-8623035 CAGAAAGAGCAAAAGCAGAGTGG + Intronic
1020553089 7:9632530-9632552 AAGAAGCAGCCAGTGAAGTGAGG - Intergenic
1020752020 7:12153633-12153655 CTGCAACAGAAAATGAAATGTGG + Intergenic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021436471 7:20623109-20623131 CAGAAACTTCAATTGGAGTGGGG + Intronic
1021564306 7:22001559-22001581 CAAAAACAGCCAATCAATTGAGG - Intergenic
1021874914 7:25039483-25039505 CATAACCACCAAATGCAGTGTGG - Intergenic
1021939390 7:25664702-25664724 AAGAAAGAGCAAAGGAGGTGGGG - Intergenic
1022481758 7:30748467-30748489 CAGAAAAAGCAAATGTACAGGGG - Intronic
1022951163 7:35339539-35339561 CAGAAACAGGAAGAGAAGAGGGG - Intergenic
1023025309 7:36044465-36044487 CAGCAACTGCAAATGGCGTGAGG + Intergenic
1023037335 7:36143630-36143652 CAGAAGCAGGAGAGGAAGTGAGG - Intergenic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1023767096 7:43521882-43521904 CAACAACAGAAAAAGAAGTGAGG + Intronic
1023885181 7:44349137-44349159 CAGACACAGCAAATGAGGTTGGG - Intergenic
1024506077 7:50162967-50162989 CAGAGACAGCAAATGAAGCATGG - Intergenic
1024589385 7:50867956-50867978 CAGATGCAGCAAAGGCAGTGAGG + Intergenic
1025164002 7:56694472-56694494 CAGAATCTGGAAATGAAATGAGG + Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1025706288 7:63867610-63867632 CAGAATCTGGAAATGAAATGAGG - Intergenic
1026376773 7:69759729-69759751 AAATAACAGCAAATAAAGTGGGG - Intronic
1028664744 7:93328577-93328599 CAGAAGCAGCAAATAGACTGTGG + Intronic
1029999370 7:105042710-105042732 AATAAAGAGCAAATGAAGTTTGG - Intronic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1030689837 7:112520855-112520877 CAGAATCAGAAGATGAGGTGGGG + Intergenic
1031150101 7:118044366-118044388 CAGAAAGAGCAAATGAAGAGTGG + Intergenic
1031942737 7:127806476-127806498 CAGAAAAACCAAAAGAAGAGAGG - Intronic
1032420539 7:131775746-131775768 CAGAACCAGGATACGAAGTGAGG - Intergenic
1032567816 7:132966210-132966232 CAGAATTACCAAATGAAGTAAGG - Intronic
1033495670 7:141892099-141892121 TAGCAAAAGTAAATGAAGTGAGG + Intergenic
1033994592 7:147330105-147330127 CAGAAAGACCAAATGATGAGAGG + Intronic
1034284831 7:149877990-149878012 CAGAAACAGACAAAGCAGTGTGG + Intronic
1036776191 8:11614363-11614385 CAGAAGCAGCGAATGAAGCCAGG + Intergenic
1037435455 8:18857920-18857942 AAGAAACAGCATATGAGGTATGG + Intronic
1037673607 8:21036152-21036174 CACAAAGATCAAATGAACTGGGG + Intergenic
1038587256 8:28801103-28801125 CAGAAACAGCAAAACATTTGGGG + Intronic
1039534168 8:38293151-38293173 AAGAAAAAGAAAAAGAAGTGGGG + Intronic
1041151326 8:54937854-54937876 CAGAAACACTAAATAAAGTTAGG + Intergenic
1042306088 8:67334724-67334746 CAATAAAAGGAAATGAAGTGTGG + Intronic
1042497222 8:69469001-69469023 TAGAAACAAGAAAGGAAGTGTGG + Intronic
1042690700 8:71495258-71495280 AAATAACAGCAAATGAACTGTGG + Intronic
1043428583 8:80172426-80172448 CTGAGGCTGCAAATGAAGTGGGG + Intronic
1044916187 8:97114832-97114854 CAGAGAGAGGAAATGAAATGAGG - Intronic
1045100538 8:98839507-98839529 CAGACACAGATAATGAAGTGTGG + Intronic
1045651135 8:104342603-104342625 CAGAAACAGTGAAGGAAGTAAGG - Intronic
1046274934 8:111946325-111946347 CAGAAACAGCAACTGGAGAAGGG + Intergenic
1046462166 8:114554024-114554046 CAGAGACAGAAAATGAACTAGGG + Intergenic
1046740253 8:117820117-117820139 GAGAGACAGCACATGAAGGGTGG - Intronic
1048484541 8:134834373-134834395 CAGAAGTAGGAAATGCAGTGAGG + Intergenic
1048843564 8:138585442-138585464 GGGAGACAGCAAAGGAAGTGTGG + Intergenic
1049883210 9:11904-11926 CAGGAACAGCAAAGGAAATCCGG - Intergenic
1050689073 9:8204777-8204799 TAGAAAAAGAAAATAAAGTGGGG - Intergenic
1051022468 9:12560612-12560634 CAGAATCAGCAAATAGATTGTGG - Intergenic
1051053922 9:12960821-12960843 CAGAAAGAGGAAATGAAGGAGGG - Intergenic
1051236689 9:15007812-15007834 CAGAAACAGCCAGAGAACTGGGG + Intergenic
1051295772 9:15594296-15594318 ATGTAACAGCAAATGAAATGTGG - Intronic
1052248129 9:26363050-26363072 TAGAAATTGAAAATGAAGTGAGG + Intergenic
1052337965 9:27338749-27338771 GAGAAACACCACAGGAAGTGGGG - Intronic
1052825151 9:33168639-33168661 CAGAAATGGCCAGTGAAGTGAGG - Intergenic
1052962522 9:34312555-34312577 CAGAAACAGAGAAAGAGGTGAGG + Intronic
1055967554 9:81880459-81880481 CATAAACAGCAACTGTAATGCGG + Intergenic
1056724744 9:89104790-89104812 CTCAAATAGCAAATGAAGGGTGG - Intronic
1058409472 9:104715384-104715406 TAGAAACAGGAAAGGATGTGTGG + Intergenic
1059845598 9:118272450-118272472 CAGAAAGAGAACATGAAGTCAGG - Intergenic
1059951118 9:119463355-119463377 CAGAAACATCAAAATAAGGGAGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060796835 9:126517609-126517631 CAAAGACAGCAAACGAAGTGGGG - Intergenic
1187294790 X:17988327-17988349 CAGGAACACCAAAAGAAATGAGG + Intergenic
1188038360 X:25343587-25343609 CAGGAATAGCAAATGATGTAGGG - Intergenic
1189836465 X:45028162-45028184 CAGCAACAGCAAACTAAGTTTGG + Intronic
1190493600 X:51006414-51006436 CAGAAACAGCCAGTGAAGGCTGG - Intergenic
1191169931 X:57433740-57433762 AAGAAACTGCAAGAGAAGTGGGG - Intronic
1193338042 X:80313550-80313572 CAGAAACAGCAAATGACAAAAGG + Intergenic
1194552113 X:95313888-95313910 CAGAAACAGAATATCAAATGTGG - Intergenic
1196409736 X:115402798-115402820 AAGAAATAGCACATCAAGTGTGG - Intergenic
1197775719 X:130117606-130117628 CAGAGTCAGCAAATGAGATGAGG + Intergenic
1198582721 X:138084053-138084075 CATAGACAGTAACTGAAGTGTGG + Intergenic
1199494688 X:148439926-148439948 CAGGAACAACAAATGAGGTCTGG - Intergenic
1200390292 X:155938209-155938231 AAGAAACAGCAGTTAAAGTGAGG - Intronic
1200402604 X:156028244-156028266 CAGGAACAGCAAAGGAAATCCGG + Intergenic
1201618015 Y:15923351-15923373 CAGGAACAGAAAATCAAGTATGG - Intergenic