ID: 1088490042

View in Genome Browser
Species Human (GRCh38)
Location 11:110378099-110378121
Sequence GCCCACTTGGACCAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088490040_1088490042 -10 Left 1088490040 11:110378086-110378108 CCGCAAGCAATCTGCCCACTTGG No data
Right 1088490042 11:110378099-110378121 GCCCACTTGGACCAAAGTGCTGG No data
1088490038_1088490042 13 Left 1088490038 11:110378063-110378085 CCAGGCTGGTCTTAAACTCTTGG 0: 111
1: 4157
2: 50794
3: 172491
4: 204555
Right 1088490042 11:110378099-110378121 GCCCACTTGGACCAAAGTGCTGG No data
1088490037_1088490042 14 Left 1088490037 11:110378062-110378084 CCCAGGCTGGTCTTAAACTCTTG 0: 110
1: 4356
2: 45753
3: 69119
4: 54931
Right 1088490042 11:110378099-110378121 GCCCACTTGGACCAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088490042 Original CRISPR GCCCACTTGGACCAAAGTGC TGG Intergenic
No off target data available for this crispr