ID: 1088494366

View in Genome Browser
Species Human (GRCh38)
Location 11:110418694-110418716
Sequence TTGAACATGCAGGAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088494366_1088494371 10 Left 1088494366 11:110418694-110418716 CCCTCCTTCTCCTGCATGTTCAA No data
Right 1088494371 11:110418727-110418749 TTCTCCTCCTTGTCTACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088494366 Original CRISPR TTGAACATGCAGGAGAAGGA GGG (reversed) Intergenic
No off target data available for this crispr