ID: 1088495357

View in Genome Browser
Species Human (GRCh38)
Location 11:110426537-110426559
Sequence GAGTGATTGGTTTGCATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088495349_1088495357 17 Left 1088495349 11:110426497-110426519 CCAACCTGTCAGATCCAAAACCC 0: 3
1: 4
2: 1
3: 9
4: 127
Right 1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG No data
1088495346_1088495357 27 Left 1088495346 11:110426487-110426509 CCCCGGAAAACCAACCTGTCAGA No data
Right 1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG No data
1088495348_1088495357 25 Left 1088495348 11:110426489-110426511 CCGGAAAACCAACCTGTCAGATC No data
Right 1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG No data
1088495350_1088495357 13 Left 1088495350 11:110426501-110426523 CCTGTCAGATCCAAAACCCTCAC 0: 4
1: 2
2: 4
3: 9
4: 106
Right 1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG No data
1088495347_1088495357 26 Left 1088495347 11:110426488-110426510 CCCGGAAAACCAACCTGTCAGAT No data
Right 1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG No data
1088495353_1088495357 -3 Left 1088495353 11:110426517-110426539 CCCTCACTAATCAATTGGTTGAG No data
Right 1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG No data
1088495351_1088495357 3 Left 1088495351 11:110426511-110426533 CCAAAACCCTCACTAATCAATTG No data
Right 1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG No data
1088495354_1088495357 -4 Left 1088495354 11:110426518-110426540 CCTCACTAATCAATTGGTTGAGT No data
Right 1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088495357 Original CRISPR GAGTGATTGGTTTGCATCCT GGG Intergenic
No off target data available for this crispr