ID: 1088500316

View in Genome Browser
Species Human (GRCh38)
Location 11:110476605-110476627
Sequence GCACCCTCTACTCACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088500311_1088500316 24 Left 1088500311 11:110476558-110476580 CCTTACTAGGTCAAGAGGCCTAG No data
Right 1088500316 11:110476605-110476627 GCACCCTCTACTCACCATGCAGG No data
1088500314_1088500316 6 Left 1088500314 11:110476576-110476598 CCTAGAAGTCTGCTGGCCAGGTC No data
Right 1088500316 11:110476605-110476627 GCACCCTCTACTCACCATGCAGG No data
1088500315_1088500316 -10 Left 1088500315 11:110476592-110476614 CCAGGTCAGCACAGCACCCTCTA No data
Right 1088500316 11:110476605-110476627 GCACCCTCTACTCACCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088500316 Original CRISPR GCACCCTCTACTCACCATGC AGG Intergenic
No off target data available for this crispr