ID: 1088504832

View in Genome Browser
Species Human (GRCh38)
Location 11:110517503-110517525
Sequence TGGGAATCTTTGGGAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088504832_1088504836 -5 Left 1088504832 11:110517503-110517525 CCAGTCTTTCCCAAAGATTCCCA No data
Right 1088504836 11:110517521-110517543 TCCCAGCATGGATTTGAAGCTGG No data
1088504832_1088504838 -4 Left 1088504832 11:110517503-110517525 CCAGTCTTTCCCAAAGATTCCCA No data
Right 1088504838 11:110517522-110517544 CCCAGCATGGATTTGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088504832 Original CRISPR TGGGAATCTTTGGGAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr