ID: 1088505580

View in Genome Browser
Species Human (GRCh38)
Location 11:110523526-110523548
Sequence GCTGGCCCCATCGTGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088505580_1088505590 13 Left 1088505580 11:110523526-110523548 CCACAGCCCACGATGGGGCCAGC No data
Right 1088505590 11:110523562-110523584 TGGCTCTGGACATGCATGCTGGG No data
1088505580_1088505588 -1 Left 1088505580 11:110523526-110523548 CCACAGCCCACGATGGGGCCAGC No data
Right 1088505588 11:110523548-110523570 CCTGGGAAGAGAACTGGCTCTGG No data
1088505580_1088505589 12 Left 1088505580 11:110523526-110523548 CCACAGCCCACGATGGGGCCAGC No data
Right 1088505589 11:110523561-110523583 CTGGCTCTGGACATGCATGCTGG No data
1088505580_1088505592 22 Left 1088505580 11:110523526-110523548 CCACAGCCCACGATGGGGCCAGC No data
Right 1088505592 11:110523571-110523593 ACATGCATGCTGGGAGGACCTGG No data
1088505580_1088505585 -7 Left 1088505580 11:110523526-110523548 CCACAGCCCACGATGGGGCCAGC No data
Right 1088505585 11:110523542-110523564 GGCCAGCCTGGGAAGAGAACTGG No data
1088505580_1088505591 16 Left 1088505580 11:110523526-110523548 CCACAGCCCACGATGGGGCCAGC No data
Right 1088505591 11:110523565-110523587 CTCTGGACATGCATGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088505580 Original CRISPR GCTGGCCCCATCGTGGGCTG TGG (reversed) Intergenic