ID: 1088505583

View in Genome Browser
Species Human (GRCh38)
Location 11:110523532-110523554
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088505583_1088505591 10 Left 1088505583 11:110523532-110523554 CCCACGATGGGGCCAGCCTGGGA No data
Right 1088505591 11:110523565-110523587 CTCTGGACATGCATGCTGGGAGG No data
1088505583_1088505589 6 Left 1088505583 11:110523532-110523554 CCCACGATGGGGCCAGCCTGGGA No data
Right 1088505589 11:110523561-110523583 CTGGCTCTGGACATGCATGCTGG No data
1088505583_1088505590 7 Left 1088505583 11:110523532-110523554 CCCACGATGGGGCCAGCCTGGGA No data
Right 1088505590 11:110523562-110523584 TGGCTCTGGACATGCATGCTGGG No data
1088505583_1088505588 -7 Left 1088505583 11:110523532-110523554 CCCACGATGGGGCCAGCCTGGGA No data
Right 1088505588 11:110523548-110523570 CCTGGGAAGAGAACTGGCTCTGG No data
1088505583_1088505592 16 Left 1088505583 11:110523532-110523554 CCCACGATGGGGCCAGCCTGGGA No data
Right 1088505592 11:110523571-110523593 ACATGCATGCTGGGAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088505583 Original CRISPR TCCCAGGCTGGCCCCATCGT GGG (reversed) Intergenic
No off target data available for this crispr