ID: 1088505586

View in Genome Browser
Species Human (GRCh38)
Location 11:110523544-110523566
Sequence AGCCAGTTCTCTTCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088505586_1088505590 -5 Left 1088505586 11:110523544-110523566 CCAGCCTGGGAAGAGAACTGGCT No data
Right 1088505590 11:110523562-110523584 TGGCTCTGGACATGCATGCTGGG No data
1088505586_1088505592 4 Left 1088505586 11:110523544-110523566 CCAGCCTGGGAAGAGAACTGGCT No data
Right 1088505592 11:110523571-110523593 ACATGCATGCTGGGAGGACCTGG No data
1088505586_1088505591 -2 Left 1088505586 11:110523544-110523566 CCAGCCTGGGAAGAGAACTGGCT No data
Right 1088505591 11:110523565-110523587 CTCTGGACATGCATGCTGGGAGG No data
1088505586_1088505589 -6 Left 1088505586 11:110523544-110523566 CCAGCCTGGGAAGAGAACTGGCT No data
Right 1088505589 11:110523561-110523583 CTGGCTCTGGACATGCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088505586 Original CRISPR AGCCAGTTCTCTTCCCAGGC TGG (reversed) Intergenic