ID: 1088505592

View in Genome Browser
Species Human (GRCh38)
Location 11:110523571-110523593
Sequence ACATGCATGCTGGGAGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088505580_1088505592 22 Left 1088505580 11:110523526-110523548 CCACAGCCCACGATGGGGCCAGC No data
Right 1088505592 11:110523571-110523593 ACATGCATGCTGGGAGGACCTGG No data
1088505583_1088505592 16 Left 1088505583 11:110523532-110523554 CCCACGATGGGGCCAGCCTGGGA No data
Right 1088505592 11:110523571-110523593 ACATGCATGCTGGGAGGACCTGG No data
1088505584_1088505592 15 Left 1088505584 11:110523533-110523555 CCACGATGGGGCCAGCCTGGGAA No data
Right 1088505592 11:110523571-110523593 ACATGCATGCTGGGAGGACCTGG No data
1088505586_1088505592 4 Left 1088505586 11:110523544-110523566 CCAGCCTGGGAAGAGAACTGGCT No data
Right 1088505592 11:110523571-110523593 ACATGCATGCTGGGAGGACCTGG No data
1088505587_1088505592 0 Left 1088505587 11:110523548-110523570 CCTGGGAAGAGAACTGGCTCTGG No data
Right 1088505592 11:110523571-110523593 ACATGCATGCTGGGAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088505592 Original CRISPR ACATGCATGCTGGGAGGACC TGG Intergenic