ID: 1088506134

View in Genome Browser
Species Human (GRCh38)
Location 11:110529338-110529360
Sequence AAGGTTAAACAACCTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088506134_1088506136 11 Left 1088506134 11:110529338-110529360 CCTTGAGCAGGTTGTTTAACCTT No data
Right 1088506136 11:110529372-110529394 GTCTTCTTACCTATAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088506134 Original CRISPR AAGGTTAAACAACCTGCTCA AGG (reversed) Intergenic
No off target data available for this crispr