ID: 1088510268

View in Genome Browser
Species Human (GRCh38)
Location 11:110566404-110566426
Sequence AAATCACCAGCTTCTTGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088510264_1088510268 4 Left 1088510264 11:110566377-110566399 CCCCAGGGTGGGTTCTCAGTAAA No data
Right 1088510268 11:110566404-110566426 AAATCACCAGCTTCTTGCGTGGG No data
1088510259_1088510268 20 Left 1088510259 11:110566361-110566383 CCTGGACGTGGCTTATCCCCAGG No data
Right 1088510268 11:110566404-110566426 AAATCACCAGCTTCTTGCGTGGG No data
1088510265_1088510268 3 Left 1088510265 11:110566378-110566400 CCCAGGGTGGGTTCTCAGTAAAT No data
Right 1088510268 11:110566404-110566426 AAATCACCAGCTTCTTGCGTGGG No data
1088510266_1088510268 2 Left 1088510266 11:110566379-110566401 CCAGGGTGGGTTCTCAGTAAATG No data
Right 1088510268 11:110566404-110566426 AAATCACCAGCTTCTTGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088510268 Original CRISPR AAATCACCAGCTTCTTGCGT GGG Intergenic
No off target data available for this crispr