ID: 1088514336

View in Genome Browser
Species Human (GRCh38)
Location 11:110613471-110613493
Sequence ATAAGATATATGGTCAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088514336_1088514341 1 Left 1088514336 11:110613471-110613493 CCCAACCTGACCATATATCTTAT 0: 1
1: 0
2: 0
3: 14
4: 206
Right 1088514341 11:110613495-110613517 TTCTCTTCCAAAATGACAGTGGG 0: 1
1: 0
2: 2
3: 34
4: 252
1088514336_1088514340 0 Left 1088514336 11:110613471-110613493 CCCAACCTGACCATATATCTTAT 0: 1
1: 0
2: 0
3: 14
4: 206
Right 1088514340 11:110613494-110613516 CTTCTCTTCCAAAATGACAGTGG 0: 1
1: 0
2: 1
3: 30
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088514336 Original CRISPR ATAAGATATATGGTCAGGTT GGG (reversed) Intronic
903807906 1:26018491-26018513 ATAAAATAAATGTCCAGGTTGGG - Intergenic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
907655250 1:56335457-56335479 ATGAGATATTTAGTCAGTTTTGG - Intergenic
908072768 1:60481704-60481726 ATCAAATATAGGGTGAGGTTTGG - Intergenic
909773931 1:79460812-79460834 GAAAGTTATATGGTCAGCTTTGG + Intergenic
910067845 1:83174728-83174750 ATGAAAAATGTGGTCAGGTTGGG + Intergenic
910475599 1:87602910-87602932 ATAAGATAATTGGCCAGGTGCGG + Intergenic
911718963 1:101168963-101168985 ATAAAAAATATGTTCAGGCTGGG - Intergenic
914928852 1:151911671-151911693 ATAAAATGTCTGGTCAGATTTGG + Intergenic
914955660 1:152159799-152159821 AGTAGATACATGGTCAGTTTTGG + Intergenic
915902828 1:159858479-159858501 GAAAGATATATGGTCAGACTGGG + Intronic
916600972 1:166293260-166293282 AAGTGATATATGGTCAGGGTTGG + Intergenic
917635519 1:176931912-176931934 ATAGGATGTATTCTCAGGTTAGG - Intronic
918615919 1:186543252-186543274 AAAAAATATATGGTCAGGTGTGG - Intergenic
920937668 1:210450566-210450588 ATAAAAGATATGGCCAGGTGCGG - Intronic
922274515 1:224064834-224064856 ATGAGATGTAAGGTGAGGTTTGG + Intergenic
924760432 1:246979637-246979659 TTAAGAAATATGGTTAGATTTGG - Intronic
1073258547 10:102171421-102171443 ATAAGTTACATGGTCATGCTGGG - Intergenic
1078138187 11:8669832-8669854 ATAAATGAGATGGTCAGGTTTGG - Intronic
1078324559 11:10369191-10369213 ATGAGATATTTGGCCTGGTTGGG + Intronic
1080589674 11:33710868-33710890 ATAAGATATATGCTCAAGAATGG + Intronic
1081123958 11:39300052-39300074 ATAAAATTTATGGCCAGGTGCGG - Intergenic
1082691945 11:56316187-56316209 ATTAGATATATGGTAATGTGTGG - Intergenic
1085099262 11:73786636-73786658 ATAAGATACATGGCCGGGTGCGG - Intergenic
1086385292 11:86301229-86301251 ATAAGATAGGTGATCAGTTTAGG + Intergenic
1086632404 11:89038973-89038995 ATAGTATATATGGTCAGGCGCGG + Intronic
1088514336 11:110613471-110613493 ATAAGATATATGGTCAGGTTGGG - Intronic
1088659614 11:112032631-112032653 GAAAGATATCTGGTAAGGTTGGG + Intronic
1088986831 11:114916714-114916736 ATAAGATCTATGGGCAGGAGAGG + Intergenic
1089477662 11:118778549-118778571 GTAAGATAGATGTTCAGGCTAGG - Intronic
1091477998 12:796162-796184 ATAAGATACATGGTCAGGAGTGG - Intronic
1093246021 12:16737638-16737660 ATAATATACTTGGTTAGGTTTGG + Intergenic
1094349850 12:29512129-29512151 ATAAGAAATATCCTCAGGTTAGG + Intronic
1095258046 12:40063950-40063972 ATAAAATATATGGCCAGGCATGG + Intronic
1096089113 12:48886785-48886807 AAAAGAGATAAGGTCAAGTTGGG - Intergenic
1096089166 12:48887107-48887129 TTAAGAGATAAGGTCAGGCTGGG - Intergenic
1096924454 12:55127706-55127728 ATAATATATATGGTCGTTTTTGG - Intergenic
1097217343 12:57424450-57424472 TTGAAATATATGGTCAGGTGTGG - Intronic
1098766217 12:74492822-74492844 ATATAATGTATGGTCAGGCTTGG + Intergenic
1099813446 12:87615766-87615788 ATCAGATTCATGTTCAGGTTAGG - Intergenic
1100608136 12:96168724-96168746 ATAAGATACATGGCCAGGCGTGG - Intergenic
1101971641 12:109318227-109318249 ATAAGAAATATGGTTACATTGGG - Intergenic
1102271238 12:111537292-111537314 ATAATATATATGGCCAGATGCGG + Intronic
1102394739 12:112575919-112575941 AAAGGATATATTGTCAGGATGGG - Intronic
1106427800 13:29649480-29649502 ATAAAATATTTGGCCAGGTGTGG + Intergenic
1106510365 13:30407913-30407935 ATAATATATATGGCCTGGTGTGG - Intergenic
1106860099 13:33896431-33896453 ATAAGTAATTTGGTCAGGTTTGG + Intronic
1106865594 13:33960567-33960589 CTAAGATTTCTGGTCATGTTGGG + Intronic
1108264012 13:48686422-48686444 ATAAGATTTGTGCTCATGTTAGG + Intronic
1108974567 13:56422331-56422353 ATAAAATATATGATCATGATAGG + Intergenic
1109278100 13:60324205-60324227 ATAAGACATCTGGCCAGGTGTGG - Intergenic
1111018058 13:82406802-82406824 ATAATAAATATGGTTAGGATAGG + Intergenic
1111736886 13:92152929-92152951 ATAAAAGTTATGGTCAGGATAGG - Intronic
1113267867 13:108639467-108639489 ATAAGATACAGGGTCTGCTTGGG - Intronic
1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG + Intergenic
1116530167 14:45961624-45961646 AAAAGATATATAATTAGGTTGGG - Intergenic
1116646998 14:47540858-47540880 ATAAAATATATAGTGTGGTTGGG - Intronic
1117247209 14:53898133-53898155 ATAACAGAACTGGTCAGGTTTGG - Intergenic
1120034930 14:79685991-79686013 ATAAGATATTTGGACATGATAGG + Intronic
1120323994 14:83002585-83002607 TTGAGGTATATGGACAGGTTTGG - Intergenic
1125315388 15:38426020-38426042 AGAAGATATATGTCCAGGTGCGG + Intergenic
1128219737 15:65960254-65960276 ATAAAATAGATGCTCAGTTTTGG - Intronic
1129055275 15:72815142-72815164 TTGAGATATATGCTCAGGTGAGG + Intergenic
1134082571 16:11335320-11335342 AGAAGGTATATGGTATGGTTCGG - Intronic
1134115768 16:11547114-11547136 ATAAGATATACAGTCACTTTTGG + Intergenic
1136620241 16:31423767-31423789 GGAAAAAATATGGTCAGGTTTGG - Intronic
1138548187 16:57731790-57731812 ATAAGACTTATGGCCAGGTGTGG + Intronic
1139491424 16:67288140-67288162 ATAAGAGAGAGGGTCAGGTTGGG - Intronic
1140667225 16:77238760-77238782 ATAATATGTTAGGTCAGGTTGGG + Intergenic
1141603468 16:85139867-85139889 ATAAAATATATGGGCAGCTCTGG + Intergenic
1142818091 17:2443787-2443809 ATAAGAAATAAGGCCAGGTGCGG - Intronic
1143414832 17:6738723-6738745 ATAACATAAACGGTTAGGTTAGG + Intergenic
1143441438 17:6977635-6977657 ATAAAATATCTGGCCAGGTGCGG + Intronic
1143965957 17:10756655-10756677 AGGAGATATCTGGCCAGGTTTGG - Intergenic
1144262244 17:13533169-13533191 TTAATATATATAGTCAAGTTAGG + Intronic
1145016771 17:19403951-19403973 ATAAGAAATGAGGTCAGGTGTGG + Intergenic
1146584408 17:34069879-34069901 AGACGGTTTATGGTCAGGTTGGG - Intronic
1146666157 17:34705321-34705343 TTAAGATATCTGGCCAGGTGTGG + Intergenic
1148388935 17:47256173-47256195 TTAAGATATCTGGTCAGGCACGG + Intronic
1148620132 17:49028242-49028264 ATAAGATACTGGGTTAGGTTTGG + Intronic
1151686719 17:75651669-75651691 TTATGATACATAGTCAGGTTTGG - Intronic
1153921060 18:9790526-9790548 AAAATATATTTGGTCAGGTGTGG - Intronic
1155221083 18:23686473-23686495 ATAAGAAATGTGGCCAGGTGTGG - Intergenic
1155764354 18:29608796-29608818 ATAAGACATAGGGTCCGGTGTGG + Intergenic
1155819405 18:30355438-30355460 ATACCATATATGGCCAGGTACGG + Intergenic
1157909766 18:51604729-51604751 AGAAAATAAATGTTCAGGTTAGG + Intergenic
1158720572 18:59920631-59920653 ATAAGATTTAAGGCCAGGTGCGG - Intergenic
1159743189 18:72199164-72199186 ATCATATATATGGCCAGGCTCGG - Intergenic
1160223022 18:76990969-76990991 ATCTGAGATAGGGTCAGGTTGGG + Intronic
1162270091 19:9607156-9607178 AAAATAAATGTGGTCAGGTTGGG - Intronic
1164113246 19:22190676-22190698 TTAAGATATATGGTCATATGAGG + Intronic
1167959692 19:53095925-53095947 AAATGATATATGGTCAGGTGCGG + Intronic
1168032244 19:53689864-53689886 ATATGATGTATGGCCAGGTGCGG + Intergenic
926028324 2:9564021-9564043 ATAAGATAAATGGCCAGGTGCGG - Intergenic
926614064 2:14977449-14977471 ATTAGAAATATCGTAAGGTTTGG + Intergenic
929725923 2:44427778-44427800 GAAAAATATATGGTCTGGTTTGG - Intronic
929834069 2:45378367-45378389 ATATAAAATATGGTCAGGCTGGG + Intergenic
929876261 2:45799395-45799417 TTAAAATATTTGGTCAGGTTTGG + Intronic
930179701 2:48341528-48341550 ACAAGTAATATGGTCAGTTTAGG + Intronic
930181299 2:48361174-48361196 ATAAAAACTATGGTCAGGTGAGG + Intronic
931522742 2:63117617-63117639 TGAAGATACATGGTGAGGTTTGG + Intergenic
935274188 2:101462128-101462150 ATAAGGGATATGGTTAGGCTGGG + Intronic
936759802 2:115763206-115763228 ATAAGATGTGTGGTATGGTTTGG + Intronic
939535252 2:143420075-143420097 ATAAGTTTTAAGGTCAGGTCAGG + Intronic
940166075 2:150773623-150773645 ATAATATTCATGCTCAGGTTAGG + Intergenic
940360986 2:152795364-152795386 AAAAGATATATGGTGAGGATGGG + Intergenic
941533879 2:166698706-166698728 AACATATATAAGGTCAGGTTTGG - Intergenic
945087594 2:206148492-206148514 TTATGATTTTTGGTCAGGTTTGG + Intronic
948045914 2:234945009-234945031 AAAAGATAAATGGCCAGGTATGG - Intergenic
1169098412 20:2924126-2924148 TTGTGATATATGGTCAGGTGTGG + Intronic
1172904982 20:38362650-38362672 ATAAAATATGAGGTCAGGTCAGG + Intronic
1173603862 20:44315538-44315560 ATAAAATATATGGCCAGGCTTGG - Intergenic
1174470612 20:50757797-50757819 ATAAAATATATTGCCAGGTCTGG + Intergenic
1174772189 20:53310733-53310755 ATGAGGTAAATGGTCATGTTGGG - Intronic
1175203640 20:57294449-57294471 TTAAAAAATATGGTCAGGGTAGG + Intergenic
1176965410 21:15207010-15207032 ATAAGATATAAGTTAAGATTAGG + Intergenic
1177417947 21:20818613-20818635 TTAGGATATATGGTTAGTTTGGG + Intergenic
1178728675 21:35078916-35078938 AGAAGATGTAGGGTCAGGTGGGG + Intronic
1179664348 21:42899869-42899891 ATGAGATACATGGCCAGGTGCGG - Intronic
1182345708 22:29662941-29662963 ACAGGAAATATGCTCAGGTTTGG - Intronic
949458211 3:4262039-4262061 ATCAGAGATGTGGTCAGTTTTGG - Intronic
949713804 3:6904498-6904520 ATAAGTTGTATCGTTAGGTTAGG + Intronic
949835030 3:8258973-8258995 ATAAGATTTATAACCAGGTTTGG + Intergenic
950602185 3:14044745-14044767 AAAAGTTATAAGCTCAGGTTTGG + Intronic
951053886 3:18125082-18125104 ATCAGAAATATGGTCATCTTAGG - Intronic
955825811 3:62946385-62946407 ATAACATATATGTTCAAATTAGG + Intergenic
956337208 3:68177543-68177565 ATTAGATATATTGTCATCTTGGG + Intronic
957016839 3:75075293-75075315 ATAAGAAATGTGTTCAGTTTGGG - Intergenic
958829302 3:99068199-99068221 ATAAGGGAGATGGTAAGGTTTGG - Intergenic
959524599 3:107362383-107362405 ATAACATGTCTGGTCATGTTGGG - Intergenic
959926500 3:111927441-111927463 ATTAGATATGCGGTCAGGTTTGG - Intronic
960156106 3:114298480-114298502 AAAGGATATATGATCAGTTTGGG - Intronic
960834662 3:121893449-121893471 ATAAGAAAGATGGTGAGTTTTGG - Intergenic
962154511 3:132931792-132931814 ATAAGATATCTGATACGGTTTGG + Intergenic
963172459 3:142264745-142264767 TTAAGATATATGGCCAGGCACGG - Intergenic
964354992 3:155842036-155842058 AAAAGATATAGGGCCAGGTGTGG - Intronic
967059422 3:185858827-185858849 ATACAATATATGGCCAGGTGCGG + Intergenic
967431512 3:189391417-189391439 AAAAGATATCTGGCCAGGTGTGG - Intergenic
967656302 3:192053805-192053827 ATAATATATATGATATGGTTTGG - Intergenic
968011791 3:195286369-195286391 ATAAGCAATATGGTAATGTTAGG - Intronic
968454846 4:692274-692296 AAAGGATCTCTGGTCAGGTTTGG + Intergenic
969932429 4:10643806-10643828 ATAAGATATTTGATGTGGTTTGG - Intronic
971613836 4:28761884-28761906 ATAAGAGATATGCTGAGGCTGGG + Intergenic
971983734 4:33792049-33792071 ATATGATAGATGGTCAGTATGGG - Intergenic
972014141 4:34223084-34223106 ACAAGATAGAAGGTGAGGTTAGG - Intergenic
973240564 4:47952065-47952087 ATAATATCTATGTTCAGGCTGGG + Intronic
979566103 4:122155737-122155759 AGAAGATACATGGTCAGATAGGG + Intronic
979756603 4:124348455-124348477 ATAAGATACAAGGTATGGTTTGG - Intergenic
980133096 4:128834848-128834870 AAAATATATATGTTCAGGATGGG + Intronic
980651688 4:135725301-135725323 ATCAAATATATGGTAAAGTTTGG - Intergenic
981803190 4:148681839-148681861 ATAATATATACAGTCAGTTTGGG + Intergenic
982697871 4:158624115-158624137 CTAAAATATATGGTCAATTTTGG - Intronic
982895658 4:160920506-160920528 ATAAGATACATGGTGAGTTTTGG - Intergenic
983984702 4:174044260-174044282 ATAAAATATTTGGTGTGGTTAGG + Intergenic
986580974 5:9265365-9265387 ATAAATTATATGGTCTGGTAGGG - Intronic
988096574 5:26619672-26619694 ATAAGATATGTCTTCATGTTAGG - Intergenic
988103529 5:26712577-26712599 ATAGGAGTTATGGTCAGTTTGGG - Intergenic
988660038 5:33256025-33256047 ATAAAATATATGGTCTGGATTGG - Intergenic
988677355 5:33446263-33446285 GTAAGATAAATGGTTAGGTAGGG - Intronic
988886570 5:35564412-35564434 ATAAGACATTTGGAAAGGTTTGG - Intergenic
992839360 5:80672349-80672371 AAAGGATATAAGGTCAGCTTTGG + Exonic
993162237 5:84307073-84307095 AAAAGATATATGATCTAGTTAGG + Intronic
994157842 5:96523329-96523351 TTAAGATATTTGGTGAGATTGGG - Intergenic
995432933 5:112102038-112102060 ATAAGATTTTTTTTCAGGTTGGG - Intergenic
995720859 5:115131040-115131062 ATAAGATATATTGCTAAGTTGGG - Intronic
995758503 5:115538888-115538910 TTTAGATCTATGGACAGGTTGGG - Intronic
998117354 5:139548317-139548339 ATAAGATATAGAGGAAGGTTGGG + Intronic
999521726 5:152357814-152357836 ATATGACACAGGGTCAGGTTTGG + Intergenic
999805754 5:155079673-155079695 TTAGGATATATGATTAGGTTAGG - Intergenic
1001054639 5:168438971-168438993 ATAGGATAGATGGTGAGGCTGGG - Intronic
1001375707 5:171255665-171255687 AAAACATATAGGGTCAGGGTTGG + Intronic
1001804086 5:174568591-174568613 AGAAGATATTTGGCAAGGTTTGG + Intergenic
1009704617 6:67231089-67231111 ATAAGATATTTGATATGGTTTGG + Intergenic
1009815486 6:68728230-68728252 ATAACATATTTGGTGATGTTTGG + Intronic
1010730668 6:79387436-79387458 AAAAGATTTATAGTCAAGTTAGG + Intergenic
1010947142 6:81988513-81988535 AGAAGAGATATGGTCAAGATTGG - Intergenic
1011852575 6:91648574-91648596 AAAAGATATCTGGTCAATTTTGG - Intergenic
1012937543 6:105383890-105383912 ATCAGATATTTAGTTAGGTTTGG - Intronic
1013338203 6:109186850-109186872 ATAAGATATATCCCAAGGTTTGG - Intergenic
1014303237 6:119709973-119709995 ATAAGGCTTCTGGTCAGGTTAGG + Intergenic
1017151234 6:151282403-151282425 TTAAGATGTATGGGCAGGCTGGG - Intronic
1019141331 6:169946085-169946107 ATAAGAAAAATGGCCAGGTGTGG - Intergenic
1020899450 7:13987285-13987307 CTAAACTATATGGTCATGTTAGG + Intronic
1022198217 7:28090398-28090420 ATAAGATGAATGGGCAAGTTAGG - Intronic
1023775622 7:43603598-43603620 ATAATATATAAGGTCAGATGTGG - Intronic
1027276250 7:76560033-76560055 ATGAAAAATGTGGTCAGGTTGGG - Intergenic
1027604077 7:80277901-80277923 ATAAGAAAGATGGACAAGTTTGG + Intergenic
1030519207 7:110576376-110576398 TTAAGATATATGATCAGATTAGG - Intergenic
1032628878 7:133624886-133624908 ATAAGAGATGAGGTCAGGCTGGG - Intronic
1037671520 8:21019360-21019382 ATAAGATATTTGTGCAAGTTAGG + Intergenic
1039586350 8:38710625-38710647 TTTAGATATATGTTCAGGCTTGG + Intergenic
1041423414 8:57694419-57694441 ATAAACTGTATGGTCAGTTTAGG - Intergenic
1041778648 8:61553462-61553484 AGATGACATATGGTCAGATTTGG - Intronic
1042136629 8:65638859-65638881 GTAGGATATATAGTCAGCTTGGG - Intergenic
1042860898 8:73312806-73312828 ATATGATTTATGGTCCTGTTTGG + Intronic
1043579576 8:81696880-81696902 ATCAAATTTATGGTGAGGTTTGG + Intergenic
1046580814 8:116090475-116090497 CTAAACTATATGGTCAGGCTAGG + Intergenic
1046605480 8:116366930-116366952 ATAAAATATATAGTCAGAATTGG - Intergenic
1050989441 9:12130297-12130319 ATGAGAAATATGGTCTAGTTTGG + Intergenic
1051073532 9:13202781-13202803 ATAAGATAAATGGTAATTTTAGG - Intronic
1052508530 9:29384359-29384381 ATAACATAAGTGGTTAGGTTGGG - Intergenic
1055272211 9:74573928-74573950 ATAAGGTCTGTGGTCAGGATAGG + Intronic
1057993249 9:99795376-99795398 AAAAGGTGTATGGGCAGGTTGGG + Intergenic
1058546037 9:106060807-106060829 ATAGGATATTTGGCCAGGTGTGG - Intergenic
1059083667 9:111276347-111276369 ATAAGATTCATGGCCAGGTGTGG - Intergenic
1060490562 9:124081119-124081141 ATAAGATATGAGGCCAGGTGCGG + Intergenic
1187124068 X:16437085-16437107 GTAAGATATATGTTCACTTTAGG - Intergenic
1188999219 X:36924458-36924480 AGAAGACATCTGGTCAGGTGTGG - Intergenic
1189613326 X:42760974-42760996 AGATGATATATGAACAGGTTTGG + Intergenic
1190401525 X:50040412-50040434 TGATGATATATGGTCAGGTAGGG - Intronic
1194133989 X:90116130-90116152 AAAATATATAGGGTCAGGGTTGG + Intergenic
1194359926 X:92937590-92937612 ATAGGATAAATCGTGAGGTTAGG - Intergenic
1194718567 X:97314111-97314133 TTAAGATATAAGGCCAGGCTGGG + Intronic
1194999066 X:100624442-100624464 AAAAGATATTTGGACAGGTCGGG + Intergenic
1197440532 X:126483154-126483176 ATAATATATATTGTCAAGTGTGG + Intergenic
1198949057 X:142049276-142049298 ATAAAAGATATGAGCAGGTTGGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200479768 Y:3686245-3686267 AAAATATATAGGGTCAGGGTTGG + Intergenic
1201307931 Y:12567180-12567202 ATAACATAATTGGTTAGGTTGGG - Intergenic
1201556674 Y:15270218-15270240 AGAACATAAATGGTTAGGTTGGG - Intergenic
1201620368 Y:15950262-15950284 ATCAAATTTATGGTGAGGTTTGG + Intergenic