ID: 1088517950

View in Genome Browser
Species Human (GRCh38)
Location 11:110658923-110658945
Sequence GTGATTAAGCAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1396
Summary {0: 1, 1: 0, 2: 40, 3: 413, 4: 942}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088517950_1088517953 10 Left 1088517950 11:110658923-110658945 CCCTCCTCACTCTGCTTAATCAC 0: 1
1: 0
2: 40
3: 413
4: 942
Right 1088517953 11:110658956-110658978 TTTAACCTAGAAAATACCCTAGG 0: 1
1: 0
2: 1
3: 20
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088517950 Original CRISPR GTGATTAAGCAGAGTGAGGA GGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
901130122 1:6957093-6957115 GTGATTCAACAGAGGGATGATGG + Intronic
901751056 1:11409010-11409032 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
901949427 1:12730268-12730290 ATGATTAAACTTAGTGAGGAAGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902873741 1:19328883-19328905 GTGAGTAGGCAGAATGAGGTAGG - Exonic
902928162 1:19711391-19711413 ATGATTAAGCTGAGTAAGAAAGG - Intronic
904265019 1:29313168-29313190 GGGAGAAAGCAGAGAGAGGAGGG - Intronic
904665386 1:32116739-32116761 ATGATTAAGCTTAGTGAGGAAGG - Intronic
904761223 1:32805625-32805647 ATGATTAAGCTTAGTGAAGAAGG - Intronic
904776932 1:32915329-32915351 ATGATTAAGCTTACTGAGGAAGG - Intergenic
905106528 1:35566342-35566364 GTGTTGCAGCAGAGTGACGATGG + Exonic
905188923 1:36217969-36217991 ATGATTAAGCTTAATGAGGAAGG + Intergenic
905545195 1:38792251-38792273 GTGTTTGAGCAGAGACAGGATGG - Intergenic
905545869 1:38800288-38800310 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
905850321 1:41269272-41269294 GTGATCCAGCAGAGTGAACAGGG - Intergenic
906558824 1:46738596-46738618 ATGATTAAGCTTAGTGACGAAGG - Intergenic
906698242 1:47839264-47839286 GTGAGCAAGCAGAGTGGGCACGG + Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907112978 1:51943497-51943519 ATAATTAAGCTTAGTGAGGAAGG + Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907548137 1:55280284-55280306 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
907685089 1:56602825-56602847 ATGATTAAGCTTAGCGAGGAAGG + Intronic
907766136 1:57412358-57412380 ATGATTAAGCTTAGTGGGGAAGG + Intronic
907802496 1:57784042-57784064 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
907869157 1:58427216-58427238 GAGATGCAGTAGAGTGAGGAGGG + Intronic
907948330 1:59156147-59156169 GTTTTTAAGCACAGAGAGGATGG + Intergenic
908091663 1:60692282-60692304 GTGATTAAACTTAGTGAGGAAGG + Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
908955319 1:69618433-69618455 GTGATTAAGCAGAGAGACACTGG - Intronic
908975401 1:69891161-69891183 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
909088450 1:71195604-71195626 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
909147287 1:71952158-71952180 ATGATTAAGGTTAGTGAGGAAGG + Intronic
909735600 1:78957310-78957332 ATAATTAAGCATAGTGAGGAAGG + Intronic
909767203 1:79371414-79371436 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
909844066 1:80368211-80368233 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
909916313 1:81324016-81324038 GAATTTAAGCAGAGTGAGGCAGG + Intronic
909964348 1:81889195-81889217 ATGATTAAGCTTAGTGAGGAAGG + Intronic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
910072021 1:83228096-83228118 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910076401 1:83284752-83284774 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910078440 1:83309025-83309047 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
910151519 1:84152945-84152967 ATGATTAAGCTTAGTAAGGATGG - Intronic
910200457 1:84692958-84692980 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910231726 1:84994875-84994897 GTGATTAAGCTTAGTGAGGAAGG - Intronic
910298403 1:85676496-85676518 ATGATTAAGCTTAGTGAGGAAGG - Intronic
910640091 1:89451036-89451058 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
910718663 1:90260244-90260266 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
910723456 1:90313012-90313034 GAGAACAAGCAGAGTAAGGAAGG + Intergenic
910732705 1:90415503-90415525 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
910918199 1:92314209-92314231 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911199097 1:95026307-95026329 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911234731 1:95399952-95399974 GAGGTCAAGCAGAGTGAAGAGGG + Intergenic
911296628 1:96125347-96125369 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
911503115 1:98713590-98713612 ATGATTAAACTTAGTGAGGAAGG - Intronic
911591394 1:99752290-99752312 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911649627 1:100373107-100373129 ATGATTAAGCTTAGTGAAGAAGG - Intronic
911868406 1:103058526-103058548 ATGATTAAGCTTAGTGAGGAAGG - Intronic
912307194 1:108580444-108580466 ATGATTAAGCTTAGTGAGGAAGG + Intronic
912874002 1:113337254-113337276 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
912902496 1:113667720-113667742 TTGATTAAGCTTAGTGAGGAAGG - Intronic
913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG + Intronic
913207322 1:116552062-116552084 ATGATTAAGCTTAGTGAGGAAGG - Intronic
913308019 1:117452329-117452351 ATAATTAAGCTTAGTGAGGAAGG + Intronic
913308021 1:117452360-117452382 GTAATTAAGCTTAGTGAGGAAGG + Intronic
913310816 1:117490668-117490690 GTAATTAAGCTTAGTGAGGAAGG + Intronic
914436187 1:147661640-147661662 ATGATTAAGCTTAGTAAGGAAGG + Intronic
914690522 1:150021984-150022006 ATGATTAAGGAGAGAGAGAAAGG - Intergenic
914774559 1:150724610-150724632 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
915518870 1:156429865-156429887 GTGATTAAGTGGTGTGTGGAGGG + Intronic
916076036 1:161200497-161200519 GTGACAAAGCAGAGTGAATAGGG - Intronic
916191563 1:162184007-162184029 ATGATTAAGCCGGGTAAGGAAGG - Intronic
916441086 1:164825293-164825315 GTGATAAAGTAGAGAGAAGAGGG - Intronic
916553119 1:165868901-165868923 ATAATTAAGCTTAGTGAGGAAGG - Intronic
916566681 1:165985065-165985087 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
916799875 1:168206899-168206921 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
917115375 1:171597910-171597932 ATGATTAAGCTTAATGAGGAAGG + Intergenic
917156142 1:172001043-172001065 TTGATTTAGGAGAATGAGGATGG + Intronic
917192322 1:172431171-172431193 ATGATTAAGCTTAGTGAAGAAGG + Intronic
917238949 1:172926266-172926288 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917362366 1:174190789-174190811 ATGATTAAGCTTACTGAGGAAGG - Intronic
917669467 1:177259013-177259035 ATGATTAGGCATAGTGAGGAAGG + Intronic
917766162 1:178219736-178219758 ATGATTAAGCTTAGTGAGGAAGG - Intronic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
917950909 1:180034915-180034937 ATGATTAAGCTTAGTGACGAAGG + Intronic
917993542 1:180409868-180409890 ATGATTAAGCTTAGTGAGGAAGG + Intronic
918130682 1:181625844-181625866 ATGATTAAGCTTAGTGAGGAAGG - Intronic
918411582 1:184263983-184264005 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
918606147 1:186428652-186428674 ATGATTAAGCTAAATGAGGAAGG - Intergenic
919113317 1:193247530-193247552 ATGATTAAGCTTAGTAAGGAAGG + Intronic
919185005 1:194134498-194134520 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
919211160 1:194488766-194488788 ATGATTAACCATTGTGAGGAAGG + Intergenic
919279303 1:195466540-195466562 GTGATTAGGGAGACTAAGGAGGG - Intergenic
919335684 1:196229579-196229601 ATGATTATGCTTAGTGAGGAAGG + Intronic
919448816 1:197745294-197745316 GTGATAAAGCTTAGTGAGGAAGG - Intronic
919487863 1:198166457-198166479 ATGATTAAGCTTAGTGAGAAAGG - Intronic
920213503 1:204345795-204345817 GTGACTCAGCAGAGAAAGGAGGG - Intronic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
920538324 1:206756520-206756542 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
920887581 1:209946268-209946290 ATGATTAATCCTAGTGAGGAAGG + Intronic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
921141901 1:212316177-212316199 ATGATTAAGCTTAGTGAGGAAGG + Intronic
921189066 1:212693954-212693976 GTGATTAAGAAGCGTGAGATGGG + Intronic
921204167 1:212833911-212833933 ATGATTAAGCTTAGTGAGGAAGG - Intronic
921276182 1:213523011-213523033 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
921278942 1:213546339-213546361 GTCAGCAGGCAGAGTGAGGATGG + Intergenic
921282021 1:213576776-213576798 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
921303944 1:213777253-213777275 ATGATTAAGCTTAGTGGGGAAGG - Intergenic
921307945 1:213815868-213815890 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
921308238 1:213818242-213818264 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
921398735 1:214696441-214696463 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
921492583 1:215796732-215796754 ATGATTAAGCTTATTGAGGAAGG + Intronic
921537981 1:216375754-216375776 ATGAGTAAGCTTAGTGAGGAAGG - Intronic
921571736 1:216787698-216787720 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
921609796 1:217197913-217197935 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
921828868 1:219704460-219704482 ATGATTAAGTTTAGTGAGGAAGG + Intronic
922065582 1:222136307-222136329 ATGATTAAACTTAGTGAGGAAGG - Intergenic
922333165 1:224595617-224595639 ATGATTTAGCTTAGTGAGGAAGG + Intronic
922588659 1:226755367-226755389 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
922727948 1:227933562-227933584 ATGATTAAGATTAGTGAGGAAGG - Intronic
922959213 1:229631478-229631500 ATAATTAAGCTTAGTGAGGAAGG - Intronic
922974570 1:229773141-229773163 GTGATCAAGCAGAGGATGGAAGG - Intergenic
923014678 1:230117425-230117447 ATGATTAAGCTTAGTGAGGAAGG - Intronic
923371995 1:233323868-233323890 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
923594678 1:235351920-235351942 GTGATTAGGAAGAATTAGGATGG - Intergenic
923763175 1:236866575-236866597 ATGATTAAGTTTAGTGAGGAAGG + Intronic
923898293 1:238297159-238297181 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
924045344 1:240024054-240024076 GTCATTAAGCTGACAGAGGAGGG - Intronic
924203532 1:241686400-241686422 GACATTAAACAGAGTGGGGAGGG - Intronic
924499838 1:244627000-244627022 ATGATTAAGCTTAGTGAGGAAGG - Intronic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1062777214 10:162013-162035 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062866025 10:855327-855349 GTGATTAAGCTTAGTAAGCAAGG - Intronic
1062890194 10:1053621-1053643 ATGATTAAGCATGGTGAGGAAGG - Intronic
1062893898 10:1088342-1088364 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062995635 10:1863732-1863754 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1063337616 10:5231592-5231614 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1063788565 10:9412977-9412999 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1064002031 10:11671767-11671789 ATGATGAAGCGTAGTGAGGAAGG - Intergenic
1064807989 10:19159425-19159447 GGCAATAAGCAGACTGAGGAAGG + Intronic
1065064818 10:21950584-21950606 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1065699982 10:28415485-28415507 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1066043377 10:31575773-31575795 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066062978 10:31740451-31740473 GTCATTCAGCAGAGTGAGAAGGG + Intergenic
1066134934 10:32435942-32435964 ATGATTAAGCTGACTGAGGAAGG - Intergenic
1066266903 10:33784815-33784837 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066478959 10:35776883-35776905 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1067548145 10:47211355-47211377 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1068127105 10:52853919-52853941 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1068220279 10:54035756-54035778 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1068304929 10:55196060-55196082 GTCATTAAGAACAGTAAGGAAGG - Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068748730 10:60566374-60566396 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1068870112 10:61934443-61934465 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1068940890 10:62680019-62680041 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1069736401 10:70657853-70657875 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070420780 10:76235042-76235064 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1070635830 10:78126419-78126441 GTGATATAGGAGAGGGAGGATGG + Intergenic
1070984384 10:80675609-80675631 ATGATTAAGCTTAGTAAGGAGGG + Intergenic
1071132726 10:82414135-82414157 ATGATTAAGCTTAGTGAGGGAGG - Intronic
1071662990 10:87524593-87524615 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1071683324 10:87729671-87729693 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1071851634 10:89577597-89577619 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1071871819 10:89803882-89803904 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1072166681 10:92820301-92820323 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1072280005 10:93857302-93857324 GTTATAAATCAGAGTTAGGAAGG - Intergenic
1072325736 10:94296833-94296855 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1072535698 10:96360931-96360953 TTGATTGATCAGAGTGAGGCAGG + Intergenic
1072601024 10:96929724-96929746 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1072889651 10:99311761-99311783 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1073615096 10:104986570-104986592 ATGATTAAGCTCAGTAAGGAAGG - Intronic
1073681511 10:105709228-105709250 ATGATTAAGCTTAGTGAGCAAGG + Intergenic
1073696305 10:105872918-105872940 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1074090918 10:110254520-110254542 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1074210714 10:111331679-111331701 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074507617 10:114085582-114085604 GAGATTCAGCCGAGTGAGGATGG - Intergenic
1074607248 10:114985531-114985553 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1074649848 10:115508424-115508446 GTGATTAAGCTTAGTGAGGAGGG + Intronic
1074671373 10:115796008-115796030 GTGCCCAGGCAGAGTGAGGAGGG - Intronic
1074691476 10:116008866-116008888 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074905253 10:117856686-117856708 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1075010128 10:118860792-118860814 ATGATTAAGTTGAGTGAGGTAGG + Intergenic
1075034716 10:119054798-119054820 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1075076123 10:119351617-119351639 TTTATCAAGCAGAGTGAGGATGG + Intronic
1075178940 10:120192356-120192378 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1075490750 10:122866905-122866927 ATGATTAAGCTTAGTGAGTAAGG + Intronic
1075596523 10:123734270-123734292 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1075751218 10:124773073-124773095 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1076251701 10:128989398-128989420 GTGATTAAGGTCAGTCAGGATGG - Intergenic
1076276398 10:129202952-129202974 GTGATTAAGCTGAGTAAGGAAGG - Intergenic
1076513453 10:131028669-131028691 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1076549509 10:131269068-131269090 ATAATTAAGCTGAGTGAAGAAGG - Intronic
1076742701 10:132494930-132494952 ATTATTAAGCTGAGGGAGGAAGG + Intergenic
1077772309 11:5233446-5233468 TTGATTAATCAGTGTGATGATGG + Intronic
1078193648 11:9115752-9115774 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1078398931 11:11006912-11006934 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1078885546 11:15496405-15496427 GTGGTGCAGTAGAGTGAGGAAGG - Intergenic
1079094764 11:17503092-17503114 GTGATTGAGGCAAGTGAGGAGGG - Intronic
1079132905 11:17759515-17759537 ATGATTACGCTTAGTGAGGAAGG - Intronic
1080842311 11:35996142-35996164 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
1080884801 11:36356931-36356953 GTGATTAAGTTTAGTGAGGAAGG + Intronic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1081094142 11:38910996-38911018 GTGATTAAGCTTAATGAGAAAGG + Intergenic
1081233346 11:40614643-40614665 ATGATTAAGCTCAGTGAAGAAGG - Intronic
1081266193 11:41025223-41025245 GTGATTAAACTTAGTGAGAAAGG + Intronic
1081485721 11:43526647-43526669 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1082200019 11:49355223-49355245 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1082230026 11:49752372-49752394 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1082761827 11:57134650-57134672 ATGATTAAGCTTAGTGAGCAAGG - Intergenic
1082923062 11:58516864-58516886 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1082954608 11:58856501-58856523 ATGATTAAGCATAGGGAGGAAGG - Intronic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1083040116 11:59677723-59677745 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1083071436 11:59987382-59987404 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1083976064 11:66121452-66121474 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1084011684 11:66353793-66353815 ATGATTACACATAGTGAGGAAGG + Intronic
1084369246 11:68728152-68728174 AAGATTAAGCTTAGTGAGGAAGG + Intronic
1084668189 11:70588324-70588346 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1084738894 11:71125248-71125270 GTGATTAAGCTTAGCAAGGAAGG + Intronic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085441187 11:76564395-76564417 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1085535783 11:77216502-77216524 GTGATCAACCAGGGTGATGAAGG - Intergenic
1086034530 11:82400685-82400707 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086121633 11:83310830-83310852 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086187156 11:84032201-84032223 ATGATTATGCTTAGTGAGGAAGG + Intronic
1086273353 11:85094879-85094901 ATGATTAAACTTAGTGAGGAAGG - Intronic
1086323553 11:85675261-85675283 ATGATTAAACTTAGTGAGGATGG - Intronic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1086620032 11:88876577-88876599 ATGATTAAGCTTAATGAGGAAGG - Intronic
1086646959 11:89234512-89234534 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1086896949 11:92324307-92324329 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1087156034 11:94904888-94904910 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1087577490 11:100007861-100007883 GAAATTAAGCTTAGTGAGGAAGG - Intronic
1087651029 11:100867778-100867800 ATCATTAAGCTTAGTGAGGAAGG - Intronic
1087913935 11:103786247-103786269 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
1088439679 11:109855932-109855954 ATGATTAAGCTTAGTGAGAACGG - Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1089415271 11:118283916-118283938 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
1089823736 11:121252545-121252567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1090260903 11:125319081-125319103 ATGATTAAGCTTAGTGAGGGAGG - Intronic
1090548133 11:127788191-127788213 GTGATTAGGGAGAGTGGTGAAGG + Intergenic
1090738041 11:129629468-129629490 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1090813157 11:130265507-130265529 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1090940876 11:131387347-131387369 GCGATGGAGCAGAGTGAAGAGGG - Intronic
1091143448 11:133256194-133256216 GTGATGAAGTATAGTGAAGAAGG + Intronic
1091515568 12:1177332-1177354 AAGATTAAGCTTAGTGAGGAAGG - Intronic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092622937 12:10293302-10293324 ATGAATAAGCTTAGTGAGGAAGG - Intergenic
1093221881 12:16431396-16431418 ATGATTAAGTTCAGTGAGGAAGG - Intronic
1093252560 12:16825311-16825333 ATGATTAAGCTTAGTGAGGCAGG + Intergenic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093427557 12:19045529-19045551 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1093450935 12:19312873-19312895 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1093617170 12:21240321-21240343 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1094112507 12:26876543-26876565 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1094205369 12:27834026-27834048 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1094280096 12:28727412-28727434 ACGATTAAGCTTAGTGAGGAAGG - Intergenic
1094632655 12:32192012-32192034 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1094637047 12:32236626-32236648 ATGATTATGCTTAGTGAGGAAGG + Intronic
1095284743 12:40395553-40395575 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095308420 12:40664848-40664870 AGGATTAAGCTTAGTGAGGAAGG + Intergenic
1095341482 12:41094276-41094298 GTGATTAAGGATATTGAGGTAGG - Intergenic
1095435508 12:42183341-42183363 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1095518404 12:43033149-43033171 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095605972 12:44068375-44068397 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095657846 12:44691566-44691588 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1095688108 12:45058740-45058762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095734430 12:45541181-45541203 GGGAATAAGAAGAGAGAGGAGGG - Intergenic
1095791207 12:46169437-46169459 TCGATTAAGCTTAGTGAGGAAGG - Intergenic
1095936801 12:47692777-47692799 ATGATTAAACTTAGTGAGGACGG - Intronic
1095985456 12:47996328-47996350 GTGACTAAGAAGAATGAAGATGG - Intronic
1096013268 12:48241985-48242007 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1096148055 12:49293022-49293044 GCCCTTAAGCAGGGTGAGGACGG + Intergenic
1096440344 12:51637345-51637367 ATGATTAAACTTAGTGAGGAAGG + Intronic
1096672818 12:53210496-53210518 GTGAGGGAGCTGAGTGAGGAGGG - Intergenic
1096761932 12:53849174-53849196 GTGCTTAAGCAAAGTGCGGGTGG - Intergenic
1096973073 12:55682833-55682855 GGGATTAAGCAGAGTGTGGACGG + Intronic
1097123651 12:56755417-56755439 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1097672018 12:62551209-62551231 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1097936419 12:65257144-65257166 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1097954745 12:65472122-65472144 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1098075184 12:66722204-66722226 ATGATTAAGCTTATTGAGGAAGG - Intronic
1098206639 12:68117837-68117859 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1098752066 12:74306199-74306221 ATGATTAATCTTAGTGAGGAAGG - Intergenic
1098800675 12:74953434-74953456 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1098905222 12:76155009-76155031 GTGATTCAGGAGGGTGAGGCAGG - Intergenic
1098921761 12:76309032-76309054 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1098936739 12:76488862-76488884 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1099162019 12:79253660-79253682 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1099609114 12:84843723-84843745 ATGATTAAGCTTATTGAGGAAGG + Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100117480 12:91325004-91325026 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1100257005 12:92894386-92894408 ATGATTAAGCTTAATGAGGAAGG + Intronic
1100468287 12:94868270-94868292 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1100516422 12:95332636-95332658 ATGATTAAGCTTAGTGAGAAGGG - Intergenic
1100616641 12:96236186-96236208 GTGTTTAAGGAGAGCCAGGAGGG + Intronic
1100695616 12:97089572-97089594 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101509394 12:105379390-105379412 GTGTTTAAGCTGAGGAAGGAGGG - Intronic
1101934888 12:109049215-109049237 ATGATTAAGCTCAGTGAGGAAGG - Intronic
1102654059 12:114465393-114465415 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104534049 12:129601517-129601539 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1105204379 13:18207982-18208004 GTGAGTAAGCAGGGTAAGAAAGG - Intergenic
1105325033 13:19363110-19363132 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1105547644 13:21362782-21362804 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1105746995 13:23386713-23386735 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1105780077 13:23697912-23697934 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1105833549 13:24187927-24187949 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1105955988 13:25283123-25283145 GTGAGTAAGAACAGAGAGGAGGG - Intronic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106987696 13:35374086-35374108 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1107143722 13:37034209-37034231 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1107277984 13:38698634-38698656 GTGAGAGAGCAGAGAGAGGAAGG + Intronic
1107287288 13:38808438-38808460 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1107459078 13:40583915-40583937 ATGATTCAGCTTAGTGAGGAAGG - Intronic
1107759674 13:43664558-43664580 GTGATCAAACAGAGTGATGGTGG - Intronic
1108010334 13:46000792-46000814 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1108181372 13:47843163-47843185 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1108274439 13:48793233-48793255 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1108278059 13:48831468-48831490 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1108293501 13:48987517-48987539 CTGACTAAGAAGGGTGAGGATGG + Intronic
1108602029 13:52003205-52003227 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1108909245 13:55522368-55522390 ATGATTAAGCTTAGTCAGGAAGG - Intergenic
1109254684 13:60064804-60064826 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1109265840 13:60199357-60199379 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1109308279 13:60663662-60663684 GTGATCAAGCAGAGGCAGGGCGG - Intergenic
1109515465 13:63438202-63438224 ACGATTAAGCTTAGTGAGGAAGG - Intergenic
1109616531 13:64841233-64841255 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
1109654062 13:65366590-65366612 GTGATGAGGCAGAGTGACGCTGG + Intergenic
1109700831 13:66022653-66022675 ATGATTAAGCTCAGTAAGGAAGG + Intergenic
1109815616 13:67579313-67579335 ATGATTAAGTTTAGTGAGGATGG - Intergenic
1109853567 13:68100884-68100906 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1109953297 13:69531109-69531131 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1110374807 13:74780962-74780984 GTGATTAAGTACATTGATGAAGG + Intergenic
1110382496 13:74869884-74869906 TTGATTAAGCTTAGTGAGGAAGG - Intergenic
1110411646 13:75210308-75210330 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1110447263 13:75599844-75599866 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1110735535 13:78931771-78931793 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1110841477 13:80148455-80148477 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1111220173 13:85194593-85194615 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1111366028 13:87246100-87246122 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1111571714 13:90096586-90096608 ATGATTAAACTTAGTGAGGATGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111787385 13:92806524-92806546 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1111839959 13:93437326-93437348 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1111899645 13:94185129-94185151 GTGAACTAGCAGAGTGGGGAAGG + Intronic
1111934581 13:94546315-94546337 GGGCTTCAGCAGAGTCAGGAAGG - Intergenic
1112208806 13:97352299-97352321 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1112521162 13:100096560-100096582 ATCATTAAGCTTAGTGAGGAAGG + Intronic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1112728824 13:102336132-102336154 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1114223750 14:20720036-20720058 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1114815434 14:25952415-25952437 ATGATTAAGCATAGTAAGGAAGG - Intergenic
1114943317 14:27644327-27644349 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
1114977298 14:28117900-28117922 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1115308251 14:31953967-31953989 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1115510381 14:34132506-34132528 GGGATTAAGGAGAATGAGGTTGG - Intronic
1115709550 14:36035803-36035825 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1116091678 14:40315712-40315734 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1116387940 14:44355775-44355797 GTGATTAATCTTAGTGAAGAAGG - Intergenic
1116445039 14:44999233-44999255 GTGTTTAAGTACAGTGAGGTAGG - Intronic
1116562157 14:46394136-46394158 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1116592345 14:46794213-46794235 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1116630262 14:47321825-47321847 GTTATTAAGGAGAGAGAAGATGG - Intronic
1116924907 14:50624656-50624678 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117201706 14:53396423-53396445 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117231259 14:53721207-53721229 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117269596 14:54128628-54128650 ATGATTAAGCTTAGTGATGAAGG + Intergenic
1117296349 14:54383076-54383098 GAGATTAAGCTTAGTGAAGAAGG + Intergenic
1117401439 14:55362062-55362084 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1117519558 14:56537236-56537258 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117586956 14:57217741-57217763 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117815338 14:59592384-59592406 CTGATTAAGGAGCTTGAGGAGGG + Intergenic
1118125018 14:62892079-62892101 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1118176693 14:63447738-63447760 GTGATTTAGCTTAGTGAGGAAGG - Intronic
1118225824 14:63898255-63898277 GTGATGCAGCAGATTGAGGCAGG - Intronic
1118507733 14:66432568-66432590 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1118518089 14:66548748-66548770 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1118560446 14:67074622-67074644 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118692985 14:68357868-68357890 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1118927963 14:70211095-70211117 ATGATTAAGCCAAGTGAGGAAGG - Intergenic
1119170583 14:72532523-72532545 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1119768417 14:77205353-77205375 GTGATAACGCAGTGTGAGAAGGG - Intronic
1119883358 14:78119784-78119806 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1120049167 14:79845384-79845406 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1120264708 14:82234140-82234162 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1121018673 14:90565370-90565392 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1121296261 14:92827646-92827668 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1121461480 14:94081975-94081997 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1121705082 14:95986538-95986560 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1121731438 14:96189975-96189997 GGGATCTAGCAGAGTGAAGACGG + Intergenic
1121766583 14:96492631-96492653 ATAATTAAGCATAGTGAGGAAGG - Intergenic
1121941430 14:98074574-98074596 GTGAGAAAGGAGGGTGAGGAAGG - Intergenic
1122001392 14:98658244-98658266 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1122054528 14:99084537-99084559 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1122201305 14:100124237-100124259 CTGACAAAGCTGAGTGAGGAAGG - Intronic
1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG + Intronic
1122522735 14:102357054-102357076 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1123485241 15:20729800-20729822 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123541729 15:21298849-21298871 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1124093358 15:26626431-26626453 ATGATTAAGCTTAGTGAGGGAGG + Intronic
1124100057 15:26684546-26684568 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1124397177 15:29312853-29312875 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1124670795 15:31636595-31636617 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1124901608 15:33828385-33828407 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1124950352 15:34313150-34313172 ATGATTAAGCTCAGTGAGAAAGG + Intronic
1124990905 15:34672509-34672531 GTAATTTAGCACATTGAGGATGG + Intergenic
1125000543 15:34765506-34765528 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1125651986 15:41324834-41324856 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1125679640 15:41522798-41522820 GGTATTAAGAAGAGAGAGGAGGG + Exonic
1125870593 15:43098002-43098024 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1126075022 15:44900735-44900757 GTGGTGAAGCCTAGTGAGGATGG + Intergenic
1126083344 15:44987087-44987109 GTGGTGAAGCCTAGTGAGGATGG - Intergenic
1126341637 15:47646987-47647009 GGGATTTAGCAGAGTATGGAGGG - Intronic
1126391713 15:48163010-48163032 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1126828277 15:52572621-52572643 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
1127206206 15:56721935-56721957 ATTATTAAGCTTAGTGAGGAAGG - Intronic
1127447109 15:59074821-59074843 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1127705195 15:61539962-61539984 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1127948605 15:63781723-63781745 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1128107469 15:65055278-65055300 GTGAGGAAGCAGTGTGAGGCAGG + Intronic
1128173920 15:65536840-65536862 ATCATTAAGCTTAGTGAGGAAGG + Intronic
1128189932 15:65682698-65682720 ATGATTAAGCTTAATGAGGAAGG - Intronic
1128305243 15:66594020-66594042 GTCTGAAAGCAGAGTGAGGATGG + Intronic
1128629337 15:69247620-69247642 ATGATTAAGCTCAGTGAGGAGGG - Intronic
1128722593 15:69961734-69961756 ATGATTAAGCATAGTGAGAAAGG + Intergenic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1129126423 15:73445539-73445561 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1129289797 15:74556110-74556132 ATTATTAAGCTTAGTGAGGAAGG - Intronic
1129499314 15:76020322-76020344 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1129948835 15:79567554-79567576 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1130408132 15:83621279-83621301 ATGATTAAGCTTAGTGAGGGAGG - Intergenic
1131169655 15:90168541-90168563 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131756558 15:95569909-95569931 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1131974142 15:97925844-97925866 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1132032394 15:98449413-98449435 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1132420970 15:101668193-101668215 ATGATTAAGCTTGGTGAGGAAGG - Intronic
1202950044 15_KI270727v1_random:25991-26013 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1133093018 16:3419736-3419758 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1133366855 16:5216949-5216971 GAGACTAAGCAGAGTGGGGTTGG + Intergenic
1134272967 16:12750301-12750323 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1135429030 16:22366598-22366620 GTCATTAAGGAGGCTGAGGAGGG + Intronic
1135766385 16:25180939-25180961 ATGATTAAGCTTGGTGAGGAAGG + Intergenic
1136118959 16:28116527-28116549 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1136319042 16:29470684-29470706 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1136433613 16:30210028-30210050 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1137416181 16:48282846-48282868 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1137627419 16:49918318-49918340 CGGAGTAAGAAGAGTGAGGACGG + Intergenic
1137740400 16:50765578-50765600 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138073028 16:54012041-54012063 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138255456 16:55554731-55554753 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1138852151 16:60641965-60641987 ATGAATCAGCAGAGTTAGGAAGG + Intergenic
1139271496 16:65687689-65687711 GTGATCAGGCAGACTGTGGATGG - Intergenic
1140157061 16:72441480-72441502 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1140398983 16:74654641-74654663 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1140549096 16:75844646-75844668 GTCATTAAGCTTAGTGAGGAAGG - Intergenic
1140574659 16:76152573-76152595 ATGATTAAGCTTAGTGAGGACGG - Intergenic
1140997627 16:80276861-80276883 GTGATTAAGAAGATTGAGATGGG + Intergenic
1141304487 16:82848835-82848857 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1142918980 17:3167885-3167907 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144165655 17:12607898-12607920 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1144265689 17:13566516-13566538 ATGATTAAACTTAGTGAGGAAGG + Intronic
1144324489 17:14165677-14165699 ATGATTAAGCTTAATGAGGAAGG + Intronic
1144530780 17:16036978-16037000 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144706858 17:17374356-17374378 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1145277706 17:21444381-21444403 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145315541 17:21730259-21730281 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1145713972 17:27002197-27002219 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1146042957 17:29474400-29474422 GTGATTAAGCTTAGTGAGAAAGG - Intronic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146115483 17:30133982-30134004 ATGATTAAGCTGATTGAGGAAGG - Intronic
1146158388 17:30544010-30544032 ATGACTAAGGATAGTGAGGAAGG + Intergenic
1146578766 17:34017502-34017524 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1147372120 17:39999625-39999647 ATGATTATGCTTAGTGAGGAAGG + Intergenic
1147659165 17:42107981-42108003 GTGGTGAAGCTGAGTGAGGCTGG - Exonic
1148003167 17:44402535-44402557 GTGATTCAGAAGGCTGAGGAGGG + Intronic
1148696238 17:49560810-49560832 ATGATTAAACTCAGTGAGGAAGG + Intergenic
1149390226 17:56182236-56182258 GTGATTCAGCTTAGTGAGGAAGG + Intronic
1150031581 17:61742458-61742480 ATGATTAAGCTTAGTGAGCAAGG - Intronic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1151027441 17:70695095-70695117 GTGATTAAACTTAGGGAGGAAGG + Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151410776 17:73926780-73926802 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1151783528 17:76263703-76263725 GAGTTTAAGCAGATTGGGGAAGG - Intergenic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1152194197 17:78907009-78907031 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1152902539 17:82951648-82951670 ATGTTTAAGCTTAGTGAGGAAGG - Intronic
1152981462 18:281585-281607 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1153126533 18:1798656-1798678 ACGATTAAGCTGGGTGAGGAAGG + Intergenic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153292785 18:3518079-3518101 ATGATTAAGCTTAGTTAGGAAGG - Intronic
1153491276 18:5650747-5650769 ATGATTAAGCATATTGAGGAAGG + Intergenic
1153568862 18:6448106-6448128 CTGCTTCAGCAGAGTGTGGAAGG + Intergenic
1153739048 18:8103826-8103848 ATTATTAAGCACAGTGAGGAAGG - Intronic
1153859682 18:9188989-9189011 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1153896346 18:9565439-9565461 ATGATTAAGCTTAGTGGGGAAGG + Intronic
1154127799 18:11708193-11708215 ATGATTAAGCTTACTGAGGAAGG - Intronic
1154249490 18:12731662-12731684 ATGATTAAGCTTATTGAGGAAGG - Intergenic
1154286050 18:13057651-13057673 TGGATTAAGCACACTGAGGAGGG - Exonic
1154341665 18:13507900-13507922 ATGATTAAACTTAGTGAGGAAGG + Intronic
1154504575 18:15022369-15022391 GTAATTCAGCAGAGAGAGCAAGG - Intergenic
1154939845 18:21100908-21100930 GTGACTAGTCACAGTGAGGAAGG - Intronic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155176390 18:23304913-23304935 GTGAATAAGAAGACTGAAGAAGG - Intronic
1155266145 18:24095799-24095821 ATGATTAAGCTTAATGAGGAAGG - Intronic
1155511911 18:26586547-26586569 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1155686223 18:28555143-28555165 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1155694300 18:28666329-28666351 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1156320938 18:36021589-36021611 GTGATGAAGTTTAGTGAGGAAGG + Intronic
1156851978 18:41739214-41739236 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1156875950 18:42011737-42011759 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1156880996 18:42079132-42079154 ATGATTAAGCCTAGTGAGAAAGG - Intronic
1157590056 18:48831087-48831109 GTGAGTGAGCAGAGTGGGGCTGG + Intronic
1157960458 18:52148190-52148212 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1158575029 18:58629498-58629520 GGGGGTAAGCAGGGTGAGGAGGG - Intergenic
1158919201 18:62170703-62170725 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1159191228 18:65045497-65045519 ATGATTAAGCCTATTGAGGAAGG + Intergenic
1159388838 18:67761605-67761627 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1159656877 18:71040433-71040455 GTGATTAAGCTTAGTGAGGAAGG + Intergenic
1159906249 18:74095335-74095357 GTGATTAAGTTTAGTGAGGAAGG - Intronic
1160117389 18:76093493-76093515 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1160218093 18:76951773-76951795 ATGATTAAGCTTAATGAGGAAGG - Intronic
1160450505 18:78961011-78961033 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1160546470 18:79660081-79660103 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161676248 19:5651681-5651703 GTGAGAAAGCACAGGGAGGAGGG - Intronic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1162262853 19:9546653-9546675 GGGATTAGAAAGAGTGAGGAGGG - Intergenic
1162843769 19:13375463-13375485 ATGATTAAACACAGTGAGGAAGG + Intronic
1162991423 19:14305062-14305084 GTCATTAAGCAGAATGAGGCAGG - Intergenic
1163565093 19:18046411-18046433 TCGATTAAGCAGGGTGGGGAGGG + Intergenic
1164490173 19:28703662-28703684 ATGATTAAGCCTAGTGAGAAAGG - Intergenic
1166392255 19:42415365-42415387 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1166557696 19:43712246-43712268 ATGATTAAGCTCAGTGAAGAAGG - Intergenic
1166580164 19:43890049-43890071 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167626850 19:50596063-50596085 ATGATTAAGTTCAGTGAGGAAGG + Intergenic
1167717151 19:51150823-51150845 GTGATTAGACAGAGGGAGGCAGG + Intronic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
1168652847 19:58103774-58103796 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1202634473 1_KI270706v1_random:31956-31978 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1202651407 1_KI270707v1_random:8089-8111 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1202660717 1_KI270708v1_random:67627-67649 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
924989673 2:301832-301854 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925153024 2:1629034-1629056 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
925168568 2:1736247-1736269 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925215522 2:2092153-2092175 ATGATTAAGCTTAGTAAGGAAGG - Intronic
925234616 2:2267018-2267040 GTGCTTCAGCACAGGGAGGATGG + Intronic
925360062 2:3272390-3272412 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925854074 2:8112661-8112683 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925871424 2:8274831-8274853 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
925954294 2:8946963-8946985 ATGATTAAGCTTAGTGACGATGG + Intronic
926387956 2:12356475-12356497 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
926462420 2:13148154-13148176 GAGAAAAAGCATAGTGAGGATGG - Intergenic
926493531 2:13555426-13555448 ATGATTAAGCTTACTGAGGAAGG - Intergenic
926608410 2:14921031-14921053 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
926649441 2:15325843-15325865 ATGATTAAGCTTAGTGAGGAAGG - Intronic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
926818525 2:16826612-16826634 ATGATTAAGATTAGTGAGGAAGG - Intergenic
926895361 2:17681457-17681479 ATGATTAAGCTTAGTGAGGAAGG - Intronic
927396413 2:22656104-22656126 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
927448052 2:23183186-23183208 ATGATTAAGTAGAGGCAGGAAGG - Intergenic
927657325 2:24960486-24960508 ATGATTAAGCTTAGTGAGGAAGG + Intronic
927755335 2:25704062-25704084 GTGATTAAGCTTAGCAAGGAAGG + Intergenic
928631240 2:33194315-33194337 ATGATTAACCTTAGTGAGGAGGG + Intronic
928657248 2:33465047-33465069 ATGATAAAGCCTAGTGAGGAAGG + Intronic
929097471 2:38277712-38277734 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
929866812 2:45724518-45724540 ATGATGAAGCTTAGTGAGGAAGG + Intronic
929971433 2:46580529-46580551 GGGAAAAAGCAGAGTGAGGGAGG - Intronic
930471712 2:51824138-51824160 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
930492016 2:52086069-52086091 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
930542147 2:52720305-52720327 GTTATAAATCAGAGTTAGGAAGG - Intergenic
930559236 2:52939502-52939524 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930948710 2:57110275-57110297 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
931013685 2:57949724-57949746 ATGATTAAGCTTAATGAGGAAGG + Intronic
931022356 2:58062438-58062460 ATAATTAAGCTTAGTGAGGAAGG + Intronic
931050713 2:58411393-58411415 ATGATTAAGATTAGTGAGGAAGG + Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
931960981 2:67482591-67482613 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
933075963 2:77927021-77927043 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933171010 2:79125167-79125189 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
933328380 2:80867116-80867138 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
933630131 2:84646435-84646457 ACGATTAAGCTTAGTGAGGAAGG + Intronic
933873604 2:86595532-86595554 ATGATTAAGATTAGTGAGGAAGG + Intronic
933896839 2:86818800-86818822 ATGATTAAGTTTAGTGAGGAAGG + Intronic
933906272 2:86896689-86896711 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
934061668 2:88299990-88300012 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
934548312 2:95237635-95237657 ATGATCAAGCTTAGTGAGGAAGG + Intronic
935460212 2:103322213-103322235 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
935608250 2:104992566-104992588 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
935776270 2:106475068-106475090 ATGATTAAGCTTCGTGAGGAAGG - Intergenic
935990371 2:108713740-108713762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
936075417 2:109398576-109398598 GTCATTGAGCTGAGTGAGAAAGG - Exonic
936257043 2:110925824-110925846 GTAATTAAGCCTAGTGAGGAAGG - Intronic
936365894 2:111854993-111855015 ATGATTAAGCTTAGTGAGGAAGG - Intronic
936409573 2:112244985-112245007 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937109973 2:119358148-119358170 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937174047 2:119908722-119908744 ATGATTAAGTTCAGTGAGGAAGG + Intronic
937461747 2:122094861-122094883 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
937767049 2:125673671-125673693 ATGATTAAACTTAGTGAGGAAGG + Intergenic
937818547 2:126281155-126281177 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
937979264 2:127604604-127604626 ATGATTAAGCTTCGTGAGGAAGG - Intronic
938022461 2:127917371-127917393 GTGATGAAGGTTAGTGAGGAAGG - Intergenic
938681961 2:133701291-133701313 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
939186015 2:138861590-138861612 GTGATGAAGCTTAGTGAGGAAGG - Intergenic
939437833 2:142201422-142201444 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
939663682 2:144922637-144922659 ATGATTAAGCTCAGCGAGGAAGG + Intergenic
939786912 2:146525972-146525994 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
939817403 2:146912608-146912630 ATAATTAAGCTCAGTGAGGAAGG + Intergenic
940037452 2:149325760-149325782 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
940410472 2:153357700-153357722 GTAATAAACCTGAGTGAGGATGG - Intergenic
940495983 2:154429205-154429227 AAGATTAAGCTTAGTGAGGAAGG + Intronic
941386200 2:164855568-164855590 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
941441575 2:165544337-165544359 GTGATTAAGGAGAGTGCTGTAGG + Intronic
941503740 2:166313815-166313837 ATGATTAAGCTTAGTGAGGAAGG - Intronic
941733036 2:168940173-168940195 ATGACTAAGCTCAGTGAGGAAGG + Intronic
941781650 2:169452223-169452245 GCTATTAAGCAGAGTGGGTATGG - Intergenic
941974583 2:171389113-171389135 AAGATTAAGCTTAGTGAGGAAGG + Intronic
942075365 2:172352351-172352373 GAGATGAGGTAGAGTGAGGAAGG + Intergenic
942246948 2:174016691-174016713 GTGACTAAGGAGACTGAGAAAGG - Intergenic
942258955 2:174138181-174138203 ATGATTAAGCTTAGTGAGGAAGG - Intronic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
942614861 2:177781040-177781062 ATGATTAAGCTTAGTGAGAAAGG - Intronic
942718539 2:178922885-178922907 GTAATTAAGAAGACTGGGGATGG - Intronic
943034503 2:182725361-182725383 ATGATTAAGCTTAGTGAGGGAGG + Intronic
943087416 2:183329390-183329412 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943251687 2:185529636-185529658 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
943330888 2:186557855-186557877 ATGATTAAGCTTAGTGAGGGAGG - Intergenic
943616545 2:190099225-190099247 ATGATCAAGCTTAGTGAGGAAGG - Intronic
943740815 2:191406427-191406449 ATGATTAAGCTTAGTGAGGAAGG - Intronic
943935468 2:193909797-193909819 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
944025851 2:195166485-195166507 ATGATTAAACCTAGTGAGGAAGG + Intergenic
944138210 2:196424407-196424429 GTGATTAAACTTAGAGAGGAAGG + Intronic
944204932 2:197148268-197148290 GGGATAAAGAAGAGTGAGGCCGG - Intronic
944273967 2:197814613-197814635 ATGATTAAGCTTAGTAAGGAAGG + Intronic
944529589 2:200654144-200654166 ATGATTAAGCTTAGTAAGGAAGG + Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944623147 2:201539839-201539861 ATGATTAAGCTTACTGAGGAAGG + Intronic
945486058 2:210397166-210397188 GTAATTAAGAAGACTAAGGATGG - Intergenic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
946083917 2:217151852-217151874 GTTATTAAGACGAGTGATGATGG + Intergenic
946524236 2:220500853-220500875 ATGGTTAAGCCTAGTGAGGAAGG + Intergenic
946713580 2:222530835-222530857 ATGATTAACCTTAGTGAGGAAGG - Intronic
946853169 2:223927769-223927791 ATGATTAAGCTTAGTGAGGAAGG - Intronic
947020709 2:225672651-225672673 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
947035472 2:225849095-225849117 ATGATTAAGCTAAGTGAGCAAGG - Intergenic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947702846 2:232249592-232249614 TTGAGTAAGCAGAGTGATGCCGG + Intronic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
947786322 2:232824256-232824278 ATGATTAAGCTTAGTGAGGAAGG + Intronic
948418406 2:237835390-237835412 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1169032815 20:2424756-2424778 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1169229100 20:3875165-3875187 GTGATTCAGGAGACTGAGGTGGG + Exonic
1169432717 20:5553494-5553516 ATGATTAAGATTAGTGAGGAAGG + Intronic
1169485212 20:6024626-6024648 ATTATTAAGCTTAGTGAGGAGGG + Intronic
1169653903 20:7900797-7900819 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1169797787 20:9483535-9483557 GAGATTATGGAGAGTGAAGAAGG + Intergenic
1170174327 20:13451842-13451864 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1170302847 20:14905460-14905482 GTGAGAAATAAGAGTGAGGAAGG + Intronic
1173381433 20:42546624-42546646 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1173707350 20:45121586-45121608 ATGATTAACCTTAGTGAGGAAGG - Intergenic
1173772514 20:45674527-45674549 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1173882641 20:46428547-46428569 ATGATTAAGCTTAGTGAGGGAGG + Intronic
1173942058 20:46919809-46919831 ACGATTAAGCTTAGTGAGGAAGG - Intronic
1174025696 20:47572501-47572523 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1174253077 20:49233877-49233899 GCGATAAAGCAAAGGGAGGAAGG - Intronic
1174650553 20:52121247-52121269 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1174850399 20:53988343-53988365 GAGACTAAGCAGAGAGAGAAAGG - Intronic
1174986242 20:55456230-55456252 GTGATAAAGCAGAGGAAGAACGG + Intergenic
1175025563 20:55898856-55898878 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1175034290 20:55985122-55985144 GTGCCCAAGCAGGGTGAGGAAGG + Intergenic
1175088363 20:56480608-56480630 ATGATTAAGCTTAGGGAGGAAGG - Intronic
1175167960 20:57059433-57059455 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1175194352 20:57232170-57232192 GGGATTAAGTAGATTGGGGAAGG - Intronic
1175649713 20:60708956-60708978 GTGACAAAGCTTAGTGAGGAAGG + Intergenic
1175854681 20:62114067-62114089 GTGATTTGGGAGACTGAGGAAGG + Intergenic
1176646694 21:9357731-9357753 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1176946058 21:14983126-14983148 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1177461438 21:21416055-21416077 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1177807693 21:25890194-25890216 GTGGATGAGCAGTGTGAGGAAGG - Intronic
1177869236 21:26550444-26550466 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1178519425 21:33275741-33275763 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178967542 21:37136279-37136301 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179429171 21:41307543-41307565 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1179965133 21:44799821-44799843 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1180113340 21:45677093-45677115 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1180328204 22:11451220-11451242 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1180366232 22:11941271-11941293 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1180417622 22:12782989-12783011 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1180932563 22:19603073-19603095 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1181403471 22:22665798-22665820 GAGATTAACCAGGGTGGGGAAGG - Intergenic
1181408474 22:22701782-22701804 GAGATTAACCAGGGTGGGGAAGG - Intergenic
1181863015 22:25834009-25834031 GTGAGGAAGCACAGTGTGGAAGG - Intronic
1181918630 22:26301532-26301554 GGAATGATGCAGAGTGAGGATGG + Intronic
1182182135 22:28361181-28361203 ATGATTATGCTTAGTGAGGAAGG + Intronic
1182457826 22:30463222-30463244 GTGATTAGGCAGAGGGAAGTGGG - Intronic
1182471638 22:30552327-30552349 TTGATTAATAAAAGTGAGGAAGG + Intergenic
1182734675 22:32523750-32523772 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1183681483 22:39332876-39332898 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1185262132 22:49873217-49873239 ATGATTAAGCTTAGTGATGAAGG - Intronic
949270206 3:2207323-2207345 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949438346 3:4053046-4053068 ATGATTAAGCTTAGTGAGGAAGG - Intronic
949728713 3:7081620-7081642 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950112679 3:10429704-10429726 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950632436 3:14291728-14291750 ATGATTAAGCTTAGTGAGGGAGG + Intergenic
950700312 3:14740147-14740169 ATGATTAACCTTAGTGAGGAAGG - Intronic
950744526 3:15076227-15076249 GTCACTAATCAAAGTGAGGAAGG + Intronic
950928127 3:16763635-16763657 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
950988879 3:17409495-17409517 ATGATTAAGCTTAGTGAGGAAGG + Intronic
951530056 3:23690371-23690393 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951851811 3:27149804-27149826 ATGATAAAGCTTAGTGAGGAAGG + Intronic
952119420 3:30224176-30224198 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
952353588 3:32564052-32564074 GTGATTCAGGAGACTGAGGTGGG + Intronic
952365478 3:32671119-32671141 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
952809980 3:37393243-37393265 ATGATTAAGCTTAGTGAGGAGGG + Intronic
952899916 3:38103639-38103661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
953174454 3:40537165-40537187 ATGATTAAGCTTAGTGAGGAAGG + Exonic
953340206 3:42127661-42127683 GTGATTAATCAAAGTGTGAATGG - Intronic
953367232 3:42355545-42355567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953436052 3:42878291-42878313 ATGATTAAGCTTAGTGAGGAAGG + Intronic
953445731 3:42964111-42964133 ATGATTAAGCTTAGTGAAGATGG + Intronic
953483987 3:43277158-43277180 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953591973 3:44266431-44266453 ATGATTAAGCTTAGTGAGGAAGG - Intronic
954020069 3:47732503-47732525 GTGATTTAGTTTAGTGAGGAAGG - Intronic
954854558 3:53632597-53632619 ATGATTAAGCTTAGTGAGGGAGG - Intronic
954942606 3:54388382-54388404 GTCATTGAGCTGGGTGAGGAAGG + Intronic
954944616 3:54409544-54409566 GTGATTAAGCTTAGTGAGGAAGG + Intronic
955211174 3:56942652-56942674 ATGATTAAGCTTAGTGAGGAAGG + Intronic
955459738 3:59168733-59168755 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
955969825 3:64427216-64427238 ATGATTAAGCTTAGTGAAGAAGG + Intronic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
956395194 3:68818517-68818539 GTGATAAAGCTTAGTGAGAAAGG - Intronic
956973926 3:74558248-74558270 AGGATTAAGAAGAGGGAGGAAGG - Intergenic
957093575 3:75756420-75756442 ATAATTAAGCTTAGTGAGGAAGG + Intronic
957400897 3:79712178-79712200 ATGATTAAGCTTGGTGAGGAAGG + Intronic
957499712 3:81038725-81038747 AAGATTAAGCTTAGTGAGGATGG - Intergenic
957536757 3:81515620-81515642 ATGATTAAGCTTAGTGAGAAAGG + Intronic
957572920 3:81971171-81971193 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
957863711 3:85994577-85994599 ATGATGAAGCTTAGTGAGGAAGG - Intronic
957955733 3:87184761-87184783 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958452128 3:94286560-94286582 ATGATTAAGGTTAGTGAGGAAGG + Intergenic
958492956 3:94801472-94801494 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958530066 3:95316883-95316905 ATGATTAAGCTTAGTGAGGACGG - Intergenic
958655516 3:96997386-96997408 ATGATTAAACTTAGTGAGGAAGG - Intronic
958933095 3:100228631-100228653 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959014333 3:101115701-101115723 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959413099 3:106049298-106049320 ATGATTAAGCTTAGTGAGGATGG + Intergenic
959546360 3:107601335-107601357 ATGATTAAGCTTATTGAGGAAGG + Intronic
959721681 3:109497875-109497897 ATGATTAAGCTTACTGAGGAAGG - Intergenic
959773099 3:110123545-110123567 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
959821140 3:110736994-110737016 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
959873540 3:111355664-111355686 ATGATGAAGCTTAGTGAGGAAGG + Intronic
959898511 3:111633047-111633069 ATAATTAAGCTTAGTGAGGAAGG - Intronic
959988389 3:112602412-112602434 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
960154599 3:114286038-114286060 ATGATTAAGCTTAGTGAAGAAGG - Intronic
960179829 3:114562639-114562661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960242243 3:115358744-115358766 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
960549324 3:118956401-118956423 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960648068 3:119912049-119912071 ATGATTAAGCTGAGCAAGGAAGG - Intronic
961092165 3:124122877-124122899 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961411596 3:126726112-126726134 ATGATTAAGCTTAGTGAGGAAGG - Intronic
961613164 3:128156925-128156947 ATGATTAAGCTTAGTGATGAAGG + Intronic
962028931 3:131578534-131578556 ATGATTAAACTTAGTGAGGAAGG + Intronic
963183823 3:142390783-142390805 ATGATTAAGCTTAGTGAAGAAGG - Intronic
963198636 3:142563728-142563750 ATGATTAAGCCTACTGAGGAAGG + Intronic
963243036 3:143029690-143029712 ATGATTAAGCTTAGTTAGGAAGG + Intronic
963283952 3:143414830-143414852 ATGATTAAGCTTAGCGAGGAAGG + Intronic
963293209 3:143514985-143515007 ATGATTAAGCTTAGTGAGGAAGG - Intronic
963608786 3:147439144-147439166 ATGATTAAGCTTAGCGAGGAAGG - Intronic
963746736 3:149131731-149131753 ATGATTAAGCTTAGTGAGGAAGG + Intronic
963946495 3:151151442-151151464 ATGATTAAGCTCAGCGAGGAAGG - Intronic
964035310 3:152188525-152188547 GAGATTAAACTTAGTGAGGAAGG + Intergenic
964439951 3:156697858-156697880 ATGATTAAGCTTAGTGGGGAAGG + Intronic
964535024 3:157711412-157711434 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
964599142 3:158475878-158475900 GTGACTAAGCTTAGTGAGGAAGG + Intronic
964823311 3:160797512-160797534 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964930148 3:162009613-162009635 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
964942183 3:162172201-162172223 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
965224198 3:165966813-165966835 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
965255657 3:166406513-166406535 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
965276374 3:166688015-166688037 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
965595527 3:170406932-170406954 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
966023985 3:175252623-175252645 ATGATTAAGCTTAGTAAGGAAGG + Intronic
966106114 3:176335930-176335952 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
966116309 3:176467477-176467499 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
966214310 3:177486262-177486284 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
966279999 3:178215018-178215040 GTCATTAAGAGGAGTGGGGAGGG - Intergenic
966282562 3:178249629-178249651 ATGATTACGCTTAGTGAGGAAGG - Intergenic
966644707 3:182231522-182231544 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
966664060 3:182450770-182450792 GAGATAAAACACAGTGAGGAGGG - Intergenic
966717412 3:183027371-183027393 ATGATTAAGTTTAGTGAGGAAGG + Intronic
966999741 3:185322563-185322585 AAGATTATACAGAGTGAGGAAGG - Intronic
967429225 3:189362180-189362202 GTGAGTGAGCAGAGAGAGAAGGG - Intergenic
967710772 3:192705216-192705238 ATGATTAAACTTAGTGAGGAAGG - Intronic
968154029 3:196363497-196363519 ATGATTAAGCTTAGTGAGAAAGG + Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969152736 4:5184146-5184168 ATAATTAAGCTTAGTGAGGAAGG - Intronic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
969834625 4:9830570-9830592 GTGCCTAAGCAGAGTGAGACGGG - Intronic
970105026 4:12572537-12572559 ATGATTCAACAGAGAGAGGAAGG - Intergenic
970264333 4:14264592-14264614 GTGATAAAGCAGTGTGAAGGTGG + Intergenic
970479211 4:16456676-16456698 ATGATTTAGCTCAGTGAGGAAGG - Intergenic
970528797 4:16960865-16960887 ATGATCAAGCTTAGTGAGGAAGG + Intergenic
970715642 4:18919265-18919287 GTGCATAAGCTGAGTTAGGATGG + Intergenic
970751031 4:19361680-19361702 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
971071179 4:23093987-23094009 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
971441282 4:26689912-26689934 ATGATTATGCCTAGTGAGGACGG + Intronic
971460757 4:26893259-26893281 GTGATTAAGAAGAGGGACTATGG - Intronic
972099418 4:35394306-35394328 ATGATTAAACATAGTGAGGAAGG + Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972234854 4:37120061-37120083 GTGAAAATGGAGAGTGAGGATGG - Intergenic
972337405 4:38119731-38119753 GTCATGAAGAGGAGTGAGGATGG + Intronic
972383498 4:38540942-38540964 GGGATTAAGCATAGTGAAGTGGG + Intergenic
972615365 4:40693078-40693100 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
973128182 4:46615048-46615070 ATGATCAAGCATGGTGAGGAAGG + Intergenic
973223944 4:47761241-47761263 ATGATTAAGTTTAGTGAGGAAGG - Intronic
973229328 4:47823912-47823934 GTGCCTAAGCAGGGTAAGGATGG - Intronic
973364174 4:49194304-49194326 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
973901215 4:55474051-55474073 GTGATTAAGCTTAGTGAGGAAGG + Intronic
974293067 4:59959332-59959354 GTTACTCAGCAGACTGAGGAGGG + Intergenic
974336900 4:60559690-60559712 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
974397044 4:61350963-61350985 ATGATTAAGCTTAGTGAGGAAGG + Intronic
974613331 4:64245951-64245973 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
974816931 4:67017106-67017128 ATGATTAAGCTAAGTGAGAAAGG - Intergenic
974859300 4:67499793-67499815 ATGATTAAGCTTAGTGAGGAAGG - Intronic
975169698 4:71219138-71219160 ATGATTAAGCTTAGTGAGGAAGG + Intronic
975240727 4:72055613-72055635 ATAATTAAGCTTAGTGAGGAAGG + Intronic
975501451 4:75090044-75090066 GTGATTAAGCTTAGTGAAGAAGG + Intergenic
975794047 4:77987456-77987478 GTGAGTAAAAAGAGTAAGGATGG - Intergenic
975940680 4:79641619-79641641 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
976154481 4:82127830-82127852 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
977069798 4:92370698-92370720 GAGAGTAAGCTTAGTGAGGAAGG + Intronic
977194434 4:94042029-94042051 ATGATTTAGCTTAGTGAGGAAGG - Intergenic
977356039 4:95948089-95948111 ATGATTAAGCTTAATGAGGAAGG - Intergenic
977401156 4:96534275-96534297 GGGATTAAGATTAGTGAGGAAGG + Intergenic
977568063 4:98601808-98601830 ATGATTAAGCTTAGTGAGGAAGG - Intronic
977887121 4:102265141-102265163 ATGATTAGGCTTAGTGAGGAGGG - Intronic
977915753 4:102590826-102590848 ATGATTAAGCTTAGTGAGGAAGG + Intronic
978083056 4:104618073-104618095 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
978102771 4:104863278-104863300 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
978125844 4:105134364-105134386 GTGATTCAGTTTAGTGAGGAAGG - Intergenic
978212110 4:106149365-106149387 ATGATTAAGCTTAGTGAGGAAGG - Intronic
978270154 4:106878967-106878989 GTGCTCAAGCAGGGTGAGAAGGG - Intergenic
978304132 4:107303663-107303685 ATGATTAAACTTAGTGAGGAAGG - Intergenic
978523518 4:109640910-109640932 ATAATTAAGCTTAGTGAGGAAGG - Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
979123685 4:116937573-116937595 ATGATTATGCTTAGTGAGGAAGG - Intergenic
979198031 4:117942982-117943004 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
979345622 4:119583584-119583606 ATGAATAAGCTTAGTGAGGAAGG - Intronic
979409045 4:120351686-120351708 GAGATTAAGAGGAGTGAGCATGG + Intergenic
979520852 4:121665063-121665085 GTGATTCAGCTTAGTGAGTAAGG - Intergenic
979694902 4:123602250-123602272 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
979744453 4:124193915-124193937 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
980221331 4:129919783-129919805 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
980549702 4:134318622-134318644 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
980719651 4:136678230-136678252 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
980768114 4:137334976-137334998 ATGTTTAAGCTTAGTGAGGAAGG - Intergenic
981191381 4:141868837-141868859 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
981391918 4:144200967-144200989 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
981554361 4:145976903-145976925 GAGACTGAGCAGGGTGAGGAGGG + Intergenic
981575860 4:146204586-146204608 ATGATTAAGCTTAGTGAGGCAGG + Intergenic
981806633 4:148723598-148723620 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
981898401 4:149832852-149832874 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
982152783 4:152480532-152480554 ATAATTAAGCTTAGTGAGGAAGG + Intronic
982169956 4:152651821-152651843 ATGATTAAGCCTTGTGAGGAAGG - Intronic
982344624 4:154343894-154343916 ATGATTAAGCATAGTGACGAAGG - Intronic
982520641 4:156412495-156412517 ATGATTAAGCTTACTGAGGAAGG - Intergenic
982575713 4:157107310-157107332 ATGATTAAGCTTAATGAGGAAGG + Intronic
982697098 4:158614843-158614865 ATGATTAAACATAGTAAGGAAGG - Intronic
982842030 4:160201090-160201112 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
983124664 4:163935934-163935956 ATAATTAAGCTTAGTGAGGAAGG - Intronic
983333129 4:166357188-166357210 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
983658473 4:170107449-170107471 ATGATTCAGCTTAGTGAGGAGGG - Intergenic
983963260 4:173779541-173779563 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
984038580 4:174700580-174700602 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
984246802 4:177284557-177284579 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
984258590 4:177416871-177416893 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984299378 4:177895348-177895370 ATGATTAAGCTTAGTGATGATGG + Intronic
984326241 4:178255219-178255241 ATGATTAATCTTAGTGAGGAAGG - Intergenic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
984545117 4:181092338-181092360 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984637123 4:182123374-182123396 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984685571 4:182664554-182664576 ATGATTAAGCTTAGTGGGGAAGG + Intronic
984971737 4:185197803-185197825 ATGATTAAGCTTAGTGAGGAAGG + Intronic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985188324 4:187342913-187342935 ATGATTAAGCTTAATGAGGAGGG - Intergenic
985311092 4:188600293-188600315 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
985328340 4:188797762-188797784 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
985430261 4:189872412-189872434 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1202761489 4_GL000008v2_random:115431-115453 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985900453 5:2785106-2785128 ATGATTAAGCTGAGCAAGGAAGG + Intergenic
986408418 5:7450157-7450179 ATGATTAAGCTTAGTGAGGAAGG + Intronic
986752824 5:10804864-10804886 ATGATTACGCTTAGTGAGGAAGG + Intergenic
986776456 5:11018440-11018462 ATGATTAAGCTTAGCGAGGAAGG + Intronic
987454719 5:18129394-18129416 ATGATTAAGCTTGGTGAGGACGG - Intergenic
987665331 5:20931143-20931165 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
987668845 5:20982464-20982486 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
987726675 5:21709547-21709569 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
987731969 5:21785403-21785425 ATGATTAAGCTCAGTGAAGAAGG + Intronic
987791261 5:22571297-22571319 ATGATTAAGCTTAGTGAGGAAGG - Intronic
988431662 5:31126012-31126034 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
988757365 5:34271041-34271063 ATAATTAAGCTCAGTGAGGAAGG + Intergenic
989001071 5:36761364-36761386 ATGATTAAGCTTAGTGATGAAGG - Intergenic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
989287808 5:39722525-39722547 ATGATTAAGCGTAGTGAGGAAGG - Intergenic
989303470 5:39922888-39922910 GTGATTAAGCTTAATGAGGAAGG - Intergenic
989303750 5:39927132-39927154 GAGTCTAAGCAGGGTGAGGAGGG + Intergenic
989324660 5:40178059-40178081 ATGATTAAGCTTATTGAGGAAGG - Intergenic
989532723 5:42526037-42526059 TTAATTAAGCTTAGTGAGGAAGG + Intronic
989654091 5:43725760-43725782 ATGATTAAGCTAAGTGAGGAAGG - Intergenic
989802286 5:45557985-45558007 ATGATTGAGCTTAGTGAGGAAGG + Intronic
990112124 5:52339555-52339577 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
990417130 5:55597285-55597307 GAGATTAAAAAGAGTCAGGAAGG + Intergenic
990481596 5:56216463-56216485 ATGATTAAGCTCAATGAGGAAGG + Intronic
990523161 5:56599372-56599394 ATGATTAAGCTTAGCGAGGAAGG - Intronic
990697470 5:58436733-58436755 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
990835922 5:60019975-60019997 ATGATTAATCTTAGTGAGGAAGG - Intronic
990850135 5:60193876-60193898 GAGAGTAAGCTGGGTGAGGAAGG - Intronic
990874605 5:60469969-60469991 ATGAATAAGCTTAGTGAGGAGGG + Intronic
990979404 5:61588354-61588376 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991188631 5:63841536-63841558 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991366858 5:65877591-65877613 GTGATTAAGCTTCATGAGGAAGG + Intergenic
991599732 5:68340484-68340506 GAGATTAACCAGGCTGAGGATGG + Intergenic
991651368 5:68858246-68858268 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
991729818 5:69574701-69574723 ATGATTGAGCTTAGTGAGGAAGG + Intronic
991806250 5:70429842-70429864 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
991865136 5:71053173-71053195 ATGATTGAGCTTAGTGAGGAAGG - Intronic
992074572 5:73179185-73179207 GAAATTAAGCTTAGTGAGGAAGG + Intergenic
992216732 5:74532128-74532150 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
992271291 5:75065941-75065963 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
992462794 5:76977776-76977798 ATGATTAAGCTTAGTGAAGAAGG + Intronic
992672095 5:79070510-79070532 GTGACTAAGCAAAATTAGGAAGG + Intronic
993082149 5:83314972-83314994 ATGATTAAGCTTAGTGAGGAAGG + Intronic
993124317 5:83813860-83813882 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993126368 5:83840902-83840924 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
993560084 5:89395971-89395993 GGAATTAAGTAGAGAGAGGAAGG - Intergenic
993588832 5:89767725-89767747 TTTATTAAGCAGTGTGAGAATGG + Intergenic
993709383 5:91209107-91209129 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993805736 5:92406803-92406825 ATGATTAAGCTTAGTGAGGAGGG + Intergenic
993897851 5:93559559-93559581 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993906434 5:93629018-93629040 ATGATTAAGCTTAGTGAGGAAGG - Intronic
994431279 5:99664710-99664732 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
994689838 5:103004064-103004086 GTGCTTAAGCAGATGGAGAAGGG - Intronic
994807852 5:104475251-104475273 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
994961071 5:106603490-106603512 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
994967141 5:106688595-106688617 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
994996668 5:107072452-107072474 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
995001597 5:107137842-107137864 ATGATTAAGCTCAGTAAGGAAGG - Intergenic
995029567 5:107464872-107464894 GTCAGGACGCAGAGTGAGGAGGG - Intronic
995296172 5:110525183-110525205 TTGATTAAAAATAGTGAGGATGG - Intronic
995339562 5:111042593-111042615 ATGATTAAACTTAGTGAGGAAGG - Intergenic
995431260 5:112080461-112080483 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
995505788 5:112859668-112859690 ATGATTAAGCTTAGTGAGGAAGG - Intronic
995658653 5:114455601-114455623 ATGATTAAGCTTAATGAGGAAGG + Intronic
995802131 5:116008461-116008483 ATGATTAAGTTTAGTGAGGAAGG + Intronic
996045788 5:118872380-118872402 ATGATTAAGCTTATTGAGGAAGG - Intronic
996067329 5:119093647-119093669 ATGATTAAGTTTAGTGAGGAGGG + Intronic
996194493 5:120586856-120586878 ATGATTAAACTTAGTGAGGAGGG + Intronic
996464905 5:123788892-123788914 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
996482924 5:123995904-123995926 ATGATTACGCTTAGTGAGGAAGG - Intergenic
996512497 5:124332652-124332674 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996526369 5:124484445-124484467 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
996807432 5:127472483-127472505 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996841952 5:127856590-127856612 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
997176230 5:131780908-131780930 ATGATCAAGCGTAGTGAGGAAGG + Intronic
997750389 5:136339026-136339048 GTTATTAAGCAGAATGAAAATGG - Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998719211 5:144924493-144924515 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
998831447 5:146163788-146163810 ATGATTAAGCTTAGTGAGGAAGG - Intronic
998863720 5:146473045-146473067 ATGATTAAGCTTAGTAAGGAAGG + Intronic
998885708 5:146691740-146691762 GTGAGTGAGCAGGGAGAGGATGG - Intronic
999095448 5:148973954-148973976 GGGACCAAGCAGAGTGAAGATGG - Intronic
999551535 5:152692788-152692810 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
999575868 5:152976024-152976046 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
999801188 5:155038646-155038668 TTGATTATGCTTAGTGAGGAAGG - Intergenic
999882630 5:155883368-155883390 ATGATTAAGCCTAGTGAGGAAGG - Intronic
1000489710 5:161896075-161896097 GAGATAAAGGAGAGTCAGGAAGG + Intronic
1000532318 5:162438527-162438549 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1000886704 5:166755886-166755908 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
1001037979 5:168311517-168311539 GTGATTAAGCAGCTTGCCGAGGG - Intronic
1001479770 5:172080398-172080420 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1001655893 5:173349356-173349378 ATGATTAAGCTTAGTGAGGATGG + Intergenic
1001960127 5:175874998-175875020 GTGATTCAGCAGAGGGATGGAGG + Intronic
1002050176 5:176566055-176566077 GAGATTAGCCAGTGTGAGGAAGG - Intronic
1003304927 6:4917798-4917820 GTAATTACCCAGAGTAAGGAGGG - Intronic
1003335584 6:5168899-5168921 GTGATAAAGGAGAGGGAGGAGGG + Intronic
1003404027 6:5813891-5813913 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1003706102 6:8532169-8532191 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1003822901 6:9919916-9919938 ATGATTAAACTTAGTGAGGAAGG + Intronic
1003830928 6:10010630-10010652 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004550352 6:16640807-16640829 ATGATTAAGCTTAGCGAGGAAGG + Intronic
1004569299 6:16829971-16829993 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1004857189 6:19763256-19763278 ATGATTAGGCATAGTGAGGAAGG + Intergenic
1004922801 6:20392727-20392749 ATGATTAAGCCTAATGAGGAAGG - Intergenic
1004972303 6:20924017-20924039 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1004972340 6:20924371-20924393 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1005689901 6:28293951-28293973 GTGATTAAGTATAGTAAGGAAGG + Intronic
1005790749 6:29297167-29297189 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1006287181 6:33105542-33105564 GTCATTAAGCAGGGGGAGGATGG + Intergenic
1006447044 6:34085425-34085447 GTGAGTCAGTAGAGAGAGGAAGG + Intronic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1006875684 6:37293684-37293706 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1006959639 6:37915428-37915450 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1007017754 6:38486397-38486419 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008255030 6:49287891-49287913 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1008299086 6:49812168-49812190 ATGAGTAAGCTTAGTGAGGAAGG - Intergenic
1008622520 6:53285102-53285124 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1008916853 6:56797420-56797442 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1008975152 6:57417404-57417426 GTGACTAAGCTTAGTGAGAAAGG - Intronic
1009164036 6:60318923-60318945 GTGACTAAGCTTAGTGAGAAAGG - Intergenic
1009479361 6:64137453-64137475 ATGATCAAGCATCGTGAGGAAGG - Intronic
1009558937 6:65213843-65213865 ATAATTAAGCATGGTGAGGAAGG + Intronic
1009590035 6:65656306-65656328 ATGATTATGCTTAGTGAGGAAGG + Intronic
1009960790 6:70518026-70518048 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1009963313 6:70551275-70551297 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1010724578 6:79318809-79318831 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1010804395 6:80217864-80217886 GTTTTTAACCAGAGTCAGGAAGG + Intronic
1011019803 6:82799822-82799844 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1011069804 6:83367923-83367945 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1011115682 6:83888759-83888781 ACGATTAAGCTTAGTGAGGAAGG + Intronic
1011218048 6:85026236-85026258 ATGATTAAGCTTAGAGAGGAAGG + Intergenic
1011303542 6:85901827-85901849 GAGAGTAGGCAGAGTGAGGCAGG + Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011675446 6:89728717-89728739 GTGATTAGGGAGACTGAGGCAGG + Intronic
1011856504 6:91699505-91699527 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1012012745 6:93810896-93810918 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1012109048 6:95203110-95203132 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1012284482 6:97372315-97372337 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1012287661 6:97412675-97412697 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1012564906 6:100636575-100636597 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1012836712 6:104278780-104278802 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1012918455 6:105196387-105196409 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1013158954 6:107522869-107522891 GTGATTAATCAGAATGTGGGAGG + Intronic
1013172661 6:107650856-107650878 GTGATTAAACTTAGTGAGGAAGG + Intronic
1013261271 6:108445480-108445502 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013922780 6:115428798-115428820 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1014262457 6:119235234-119235256 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1014775157 6:125500368-125500390 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1014975539 6:127877407-127877429 ATGATTAAGCTTAGTGTGGAAGG - Intronic
1015009967 6:128333858-128333880 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1015144858 6:129974170-129974192 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1015259586 6:131221023-131221045 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1015304196 6:131688402-131688424 ATGATTAAGCTTAATGAGGAAGG + Intronic
1015337035 6:132051178-132051200 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015555755 6:134459752-134459774 TTCTTTAATCAGAGTGAGGAGGG - Intergenic
1015640744 6:135328731-135328753 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1015648273 6:135420898-135420920 GTGATTGAGGTCAGTGAGGAAGG - Intronic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1015939744 6:138436176-138436198 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016792366 6:148079173-148079195 GTGAGGAAGGAGAGTGAAGAGGG + Intergenic
1016794079 6:148099152-148099174 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1016836398 6:148481476-148481498 ATGATTAAGCTTAGTGAGGAGGG - Intronic
1016848021 6:148588190-148588212 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016850768 6:148616535-148616557 GTGATGAAGCAGAGAGGGGAAGG + Intergenic
1016867409 6:148781118-148781140 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016903284 6:149123328-149123350 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016931573 6:149415879-149415901 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1016946185 6:149536360-149536382 ATGATTAAGCATAGTGAGAAAGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1016999752 6:149988555-149988577 GTGAGGAAGAAGAGTCAGGAGGG + Intergenic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017006864 6:150033719-150033741 GTGAGGAAGAAGAGTCAGGAGGG - Intergenic
1017385003 6:153873217-153873239 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1017461017 6:154650499-154650521 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1017734692 6:157350623-157350645 ATGGTTAAGCTCAGTGAGGAAGG + Intergenic
1017799585 6:157881495-157881517 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1018219625 6:161565330-161565352 GTCATTTAGGAGGGTGAGGAGGG - Intronic
1018224173 6:161611787-161611809 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1018271439 6:162082644-162082666 ATGATTGAGCTCAGTGAGGAAGG - Intronic
1018294764 6:162333776-162333798 ATGATAAAGCTCAGTGAGGAAGG + Intronic
1018599228 6:165521402-165521424 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1018691716 6:166350737-166350759 ATTATTAAGCATATTGAGGAAGG - Intergenic
1018881393 6:167885358-167885380 TTGATTAAACATAGTGAGAAAGG - Intronic
1019061679 6:169261991-169262013 CTAATTAAGCTTAGTGAGGAAGG + Intergenic
1019629213 7:2037915-2037937 AGGATTAAGCTTAGTGAGGAAGG + Intronic
1019821984 7:3251016-3251038 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1020090893 7:5340087-5340109 ATGATTAAACTTAGTGAGGAAGG + Intronic
1020423824 7:8040998-8041020 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020596857 7:10217507-10217529 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1020664563 7:11023936-11023958 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020931702 7:14404932-14404954 GAGATTAACCAGGGAGAGGATGG - Intronic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1020950418 7:14669102-14669124 GTCATTAGCTAGAGTGAGGATGG - Intronic
1021132781 7:16931365-16931387 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1021267960 7:18548002-18548024 ATGATTAAGCTGAGTTAGGAAGG - Intronic
1021934091 7:25613186-25613208 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1022063269 7:26822981-26823003 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1022066720 7:26865935-26865957 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022144995 7:27528334-27528356 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022197171 7:28080517-28080539 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1022411513 7:30141977-30141999 GTGCTTAAGCAGGGTGGGGGTGG - Intronic
1022548879 7:31217504-31217526 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1023026095 7:36051107-36051129 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023724380 7:43127077-43127099 ATGATCAAGCTTAGTGAGGACGG + Intronic
1023773233 7:43579144-43579166 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1024094254 7:45971807-45971829 CTGATGATTCAGAGTGAGGAGGG - Intergenic
1024133320 7:46379623-46379645 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1024549327 7:50548301-50548323 ATGATTCAGCTGAGTGAGGAAGG + Intronic
1024786131 7:52910400-52910422 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1025195928 7:56933396-56933418 ATGATTAAGCTCAGCGAGGAAGG + Intergenic
1025676020 7:63643540-63643562 ATGATTAAGCTCAGCGAGGAAGG - Intergenic
1026256103 7:68713213-68713235 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1026507741 7:71000206-71000228 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1026869001 7:73839622-73839644 GTGAGGAAGCAGTGAGAGGAAGG + Intronic
1027006055 7:74693951-74693973 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1027289735 7:76693075-76693097 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027294178 7:76750049-76750071 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027490320 7:78815940-78815962 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1027512065 7:79095467-79095489 ATGATTAGGCTTAGTGAGGAAGG - Intronic
1027623128 7:80517484-80517506 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1027631999 7:80618443-80618465 GTGATTAAACTTAGTGAGGAAGG + Intronic
1028408605 7:90503482-90503504 ATGATTAAACTTAGTGAGGAAGG - Intronic
1028578205 7:92377114-92377136 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1028603482 7:92628992-92629014 AGGATTAAGGAGAGTGGGGAGGG + Intronic
1028660951 7:93274183-93274205 ATGATTAAGCTTAGTGAAGATGG + Intronic
1028944643 7:96563307-96563329 GTCATTATTGAGAGTGAGGATGG + Intronic
1029340826 7:99943447-99943469 GTGATTTTGCAGAGCGGGGAAGG - Intergenic
1029674181 7:102055758-102055780 ATGATTAAGCTCAGTGAGAAAGG + Intronic
1030022510 7:105289820-105289842 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1030136859 7:106260629-106260651 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1030151097 7:106405956-106405978 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030387330 7:108880223-108880245 ATAATTAAGCTGAGTGAGGAAGG + Intergenic
1030450239 7:109700042-109700064 GTGATAACCCAGATTGAGGATGG - Intergenic
1030495010 7:110287935-110287957 GTGATTAAGCTTAGTGAGAAAGG - Intergenic
1031281740 7:119811572-119811594 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1032180868 7:129676344-129676366 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1032235501 7:130118640-130118662 TTGACTAAGCTTAGTGAGGAAGG - Intronic
1032622360 7:133548959-133548981 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1032701616 7:134385326-134385348 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1032730366 7:134636195-134636217 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1032769025 7:135029745-135029767 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032778899 7:135146033-135146055 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1033080558 7:138293036-138293058 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1033112484 7:138593558-138593580 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1033241608 7:139684392-139684414 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1033386496 7:140881663-140881685 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1033388440 7:140902509-140902531 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1033393870 7:140955627-140955649 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1033987202 7:147240752-147240774 GTAATTAAACAAAGTGAGGTTGG - Intronic
1034134112 7:148749772-148749794 ATGATTAAGCCAAATGAGGAAGG + Intronic
1034316805 7:150140784-150140806 TTGATTATGCTGAGTGAGGAAGG + Intergenic
1034568806 7:151938037-151938059 GTAATTAAGCTAAGTGAGGAAGG + Intergenic
1034582776 7:152060444-152060466 GTAATTTAGCTTAGTGAGGAAGG - Intronic
1034743314 7:153498368-153498390 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034743319 7:153498424-153498446 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034790056 7:153959900-153959922 ATGATTATGCTGAGTGAGGAAGG - Intronic
1035167096 7:156997939-156997961 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1035280697 7:157776360-157776382 GTGAGGAAGAAGAGAGAGGAGGG - Intronic
1035340448 7:158157405-158157427 GTGTTTAAGCAGAGTCTGTAAGG + Intronic
1036110128 8:5889761-5889783 GTGATGATGCAGGGAGAGGATGG - Intergenic
1036735688 8:11313507-11313529 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1037145908 8:15572629-15572651 ATGATTAAACTTAGTGAGGAAGG - Intronic
1037218530 8:16487801-16487823 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1037263390 8:17033175-17033197 ATGATTAAGCTTAATGAGGAAGG + Intronic
1037447676 8:18983459-18983481 ATGATTAAGCTTAGTGAGAAGGG - Intronic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1038025640 8:23587113-23587135 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1039381980 8:37094005-37094027 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1039556198 8:38476980-38477002 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1039983866 8:42431105-42431127 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1040436138 8:47393543-47393565 TTAATTAGGCAGAGAGAGGAGGG - Intronic
1040459808 8:47636460-47636482 GTGATTAAGCTTAGTGGGGAAGG + Intronic
1040485209 8:47864637-47864659 GTGCCACAGCAGAGTGAGGAGGG + Exonic
1040636286 8:49277389-49277411 GTAATTAAGCTTAATGAGGAAGG + Intergenic
1040833101 8:51699655-51699677 ATGATTATGCTTAGTGAGGAAGG - Intronic
1040911080 8:52519803-52519825 GTGATTAAGGATATTGAGGTGGG - Intergenic
1041475994 8:58266556-58266578 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
1041755145 8:61305338-61305360 GTGGTTAATCAGAGAGGGGAAGG - Intronic
1041822295 8:62050772-62050794 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1042045525 8:64646988-64647010 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1042419401 8:68567885-68567907 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1042441010 8:68826609-68826631 ATGATTAAGCTCGGTGAGGAAGG - Intergenic
1042548029 8:69968219-69968241 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1042635719 8:70871788-70871810 GTGATTAAGCTATGTGAGGCAGG + Intergenic
1042785813 8:72545721-72545743 AGGATTAAGCTTAGTGAGGAAGG + Intronic
1042851768 8:73223880-73223902 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1042882397 8:73508216-73508238 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1043099024 8:76016341-76016363 ATGATTAAGCTGAGTGATGAAGG + Intergenic
1043509258 8:80933443-80933465 TTAATTAATCAGAGTGAAGAGGG + Intergenic
1043862736 8:85339607-85339629 ATGATTAAGCTCAGTGAAGAAGG + Intronic
1044030876 8:87235360-87235382 ATGATTAACCTGAGTAAGGAAGG - Intronic
1044044121 8:87409075-87409097 ATGATTAAGCTTAATGAGGAAGG + Intronic
1044089770 8:87984839-87984861 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1044216821 8:89621810-89621832 GTTATTAAGCAGAGTTCTGAGGG + Intergenic
1044668996 8:94659592-94659614 ATGATTAAGCTTAGTCAGGAAGG + Intronic
1045038669 8:98199343-98199365 ACGATTAAGCTTAGTGAGGAAGG - Intronic
1045073155 8:98532164-98532186 ATGATTAAACTTAGTGAGGAAGG - Intronic
1045129527 8:99133557-99133579 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1045158320 8:99505339-99505361 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1045232925 8:100322650-100322672 ATGATTAAGCTTAATGAGGAAGG - Intronic
1045253256 8:100498798-100498820 GTGCTTAGACAGAGTTAGGAAGG - Intergenic
1045417108 8:101978350-101978372 GTCAGTAATGAGAGTGAGGATGG - Intronic
1045563523 8:103289829-103289851 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045889586 8:107139109-107139131 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045907808 8:107369562-107369584 ATAATTAAGCATAGTGAAGAAGG - Intronic
1045948342 8:107823383-107823405 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1045967065 8:108037120-108037142 GTGATTAAGCTTAGTGAGCAGGG + Intronic
1046316780 8:112513262-112513284 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1046545499 8:115644707-115644729 ATGATTATGCTTAGTGAGGAAGG - Intronic
1046571739 8:115974800-115974822 ATGATTAAGCTTAATGAGGAGGG - Intergenic
1046743822 8:117855998-117856020 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1047009882 8:120660730-120660752 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1047400663 8:124543931-124543953 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1047560415 8:125981648-125981670 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1047630743 8:126705127-126705149 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047650831 8:126918375-126918397 GACATGAAGCAGAGTGTGGAAGG - Intergenic
1047794933 8:128245534-128245556 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048824319 8:138409097-138409119 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1048902484 8:139052094-139052116 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1049018237 8:139936641-139936663 GTGATAAAGCAGGGAGAGAATGG + Intronic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049629102 8:143642559-143642581 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1049739481 8:144230473-144230495 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050349578 9:4727777-4727799 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050383772 9:5061810-5061832 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050437296 9:5624632-5624654 ATGATTAAACTAAGTGAGGAAGG - Intergenic
1051064420 9:13085183-13085205 ATGATTAGGCTGAGTGAGGAAGG + Intergenic
1051085008 9:13338284-13338306 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1051123770 9:13780530-13780552 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
1051254149 9:15195009-15195031 ATAATTAAGCGTAGTGAGGAAGG + Intronic
1051298258 9:15619244-15619266 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1051601678 9:18881290-18881312 ATGATTAAGCTTAGTGGGGAAGG - Intronic
1051721638 9:20043111-20043133 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1051852987 9:21530514-21530536 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1051888901 9:21923687-21923709 GTCCTTAAGCACATTGAGGAGGG - Intronic
1052186613 9:25604539-25604561 AAGATTAAGCTTAGTGAGGAAGG + Intergenic
1052734580 9:32327836-32327858 GTGATTAAGCTTAGTGAGAAAGG - Intergenic
1053091488 9:35281925-35281947 GGGAATAAGAAGAGTGGGGAAGG + Intronic
1053250341 9:36568924-36568946 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1053296494 9:36918180-36918202 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1053465614 9:38305922-38305944 ATGATCAAGCTTAGTGAGGAAGG - Intergenic
1053486143 9:38457870-38457892 CTGTTTCAGCAGAGTGATGAGGG + Intergenic
1053575094 9:39351539-39351561 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053839600 9:42179474-42179496 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054096659 9:60910222-60910244 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054118062 9:61185848-61185870 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1054589693 9:66996716-66996738 ATGATTAAGGTGAGTGAGGAAGG - Intergenic
1054796566 9:69307650-69307672 GTGATTCTGCAGAGTGAGGGTGG + Intergenic
1054839431 9:69720116-69720138 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1054994516 9:71370277-71370299 ATAATTAAGCTTAGTGAGGATGG + Intronic
1055150690 9:72995406-72995428 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1055189969 9:73506750-73506772 GTGATTAAGCTTAGTTAAGAGGG + Intergenic
1055297094 9:74844821-74844843 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1055434637 9:76280417-76280439 TTGATTAAGCTTAGTGAGGAAGG + Intronic
1055557162 9:77486570-77486592 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1055906537 9:81301009-81301031 GTGATTAAGCTTAGTGAGAAAGG + Intergenic
1056058447 9:82855052-82855074 ATGATTAAACATAGTAAGGAAGG - Intergenic
1056241574 9:84652954-84652976 GTAATCAAGAAGAGTGATGAGGG + Intergenic
1056336102 9:85570837-85570859 GAGCCTAAGCAGGGTGAGGAAGG + Intronic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056959604 9:91111437-91111459 ATGATTAAGCTTAGTGAGTAAGG - Intergenic
1056979265 9:91293268-91293290 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1057287353 9:93768741-93768763 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1057370578 9:94469153-94469175 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1057539007 9:95947101-95947123 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1057823695 9:98354938-98354960 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1058348764 9:103996713-103996735 ATGATTAAGCTTATTGAGGATGG - Intergenic
1058628130 9:106957113-106957135 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059092984 9:111381139-111381161 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059158128 9:112007849-112007871 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1059290087 9:113215217-113215239 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1059558912 9:115311931-115311953 ATGATTAAACTCAGTGAGGAAGG + Intronic
1059711862 9:116875114-116875136 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1059917506 9:119119761-119119783 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1060066465 9:120505534-120505556 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1060386092 9:123230089-123230111 GAATTTAAGCTGAGTGAGGAAGG + Intronic
1060843963 9:126819723-126819745 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1061121500 9:128645729-128645751 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG + Intergenic
1062095176 9:134699433-134699455 GGGAGGAAGCAGAGAGAGGAAGG - Intronic
1062142604 9:134967880-134967902 CTGATTAATCAGGGGGAGGAAGG + Intergenic
1203483861 Un_GL000224v1:33295-33317 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1203708833 Un_KI270742v1:77266-77288 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1203542260 Un_KI270743v1:100308-100330 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
1186839293 X:13469091-13469113 GTGATTAGGCAGAGAGATGCTGG - Intergenic
1186969852 X:14829957-14829979 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1187026669 X:15442499-15442521 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1187516629 X:19977252-19977274 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1187524358 X:20040492-20040514 ATGATTGAGCTCAGTGAGGAAGG - Intronic
1187662912 X:21570600-21570622 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1187692254 X:21881156-21881178 AAGATTAATCAGAGTGAGAAAGG + Intronic
1187814933 X:23221250-23221272 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1187908787 X:24091380-24091402 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1188278859 X:28238072-28238094 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1188299240 X:28487189-28487211 GTGATTAAGAATATTGAGGTGGG - Intergenic
1188448232 X:30280125-30280147 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1188822111 X:34788279-34788301 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1189014552 X:37083290-37083312 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
1189174577 X:38942806-38942828 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189708638 X:43785607-43785629 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1189788029 X:44577193-44577215 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1189827790 X:44937768-44937790 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1189830240 X:44965404-44965426 ATCATTAAGCTTAGTGAGGAAGG - Intronic
1190460801 X:50671885-50671907 ATGCTTAAGCTTAGTGAGGAAGG - Intronic
1190482977 X:50896197-50896219 TTGATTAAGCTTAGTGAGAAAGG - Intergenic
1190715679 X:53101267-53101289 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
1191167921 X:57411150-57411172 ATAATTAAGAAGAGTGAAGAAGG - Intronic
1191957757 X:66664729-66664751 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1192084593 X:68083684-68083706 ATGATTAAGCTTAGTTAGGAAGG - Intronic
1192091681 X:68165298-68165320 ATGATTAAGCTTAATGAGGAAGG - Intronic
1192388635 X:70700689-70700711 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1192754541 X:74033647-74033669 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1193164945 X:78268252-78268274 GTGATTTAGCAGAGTTACCATGG + Intergenic
1193867256 X:86749320-86749342 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1193971277 X:88057009-88057031 ATGATTAAGCTTTGTGAGGAAGG + Intergenic
1194364727 X:93000843-93000865 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1194588637 X:95769492-95769514 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194591241 X:95802520-95802542 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194624407 X:96212270-96212292 GTAATTTAGCAGTGTGAGAATGG - Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1195338748 X:103883608-103883630 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1195582114 X:106517081-106517103 GTGATGGAGCTAAGTGAGGAGGG + Intergenic
1195828070 X:109024686-109024708 GGGATTAAGCTGACAGAGGAAGG - Intergenic
1195987907 X:110651206-110651228 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
1196029342 X:111078713-111078735 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1196260351 X:113572017-113572039 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1196849160 X:119921236-119921258 GTGATTATTCAGTGTGAGGATGG - Intergenic
1197114065 X:122811182-122811204 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1197129334 X:122986612-122986634 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197358576 X:125468455-125468477 GTAATTAAGCTTAGTGAAGAAGG - Intergenic
1197456359 X:126680699-126680721 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197977730 X:132183127-132183149 GAGATTGAGCACAGTGAGAATGG - Intergenic
1198034622 X:132788587-132788609 ATGATTAAACTTAGTGAGGAAGG + Intronic
1198199699 X:134403131-134403153 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1198323126 X:135539646-135539668 ATGATTAAACTTAGTGAGGAAGG - Intronic
1198542915 X:137659307-137659329 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1198621341 X:138514108-138514130 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198690349 X:139276623-139276645 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1199260182 X:145764061-145764083 ATGATTAAGCTTAGGGAGGAAGG + Intergenic
1199343776 X:146714348-146714370 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1199401184 X:147400739-147400761 GTGCTTAAGCAGAGAAAAGATGG - Intergenic
1199916829 X:152351752-152351774 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1200013786 X:153142754-153142776 ATTATTAAGCTCAGTGAGGAGGG + Intergenic
1200019780 X:153192850-153192872 GAGATTAAGAAGAGTGAGTCAGG - Intergenic
1200025815 X:153257201-153257223 ATTATTAAGCTCAGTGAGGAGGG - Intergenic
1200094976 X:153654270-153654292 GTGATACAGCAGAATGTGGAGGG + Intergenic
1200367402 X:155681513-155681535 GTGATTAAGCTTAGGGAGGAAGG + Intergenic
1200478995 Y:3676907-3676929 GGCATTACGCAGAGAGAGGAAGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic